NAAS Score 2020

                   5.36

UserOnline

Free counters!

Previous Next

Coagulase Gene Polymorphism in Staphylococcus Aureus Isolated From Chicken and Pork Marketed in Retail Outlets of Chennai

Savariraj Wilfred Ruban Ravindran Narendra Babu Robinson J. J. Abraham Veluru Appa Rao Kannan Porteen Paramasivam Raja
Vol 7(6), 192-197
DOI- http://dx.doi.org/10.5455/ijlr.20170430054718

The present study was carried out to determine polymorphism in coagulase gene in S. aureus isolated from retail chicken and pork meat marketed in Chennai. A total of 94 S. aureus isolates viz., 46 isolates from chicken meat and 48 isolates from pork which were confirmed by standard biochemical methods were used in the study. PCR based on coa gene revealed nine and eleven different banding patterns in chicken and pork isolates respectively. Of the 46 chicken isolates, 37 (80.43 %) revealed single pattern and 9 isolates revealed multiple banding pattern (19.57 %). Majority of the chicken isolates amplified 891 bp coa product. Of the 48 pork isolates, 35 isolates (72.91 %) amplified multiple banding pattern and 13 isolates (27.08 %) showed distinctive single band pattern. Majority of the pork isolates produced double banding pattern of 723 and 891 bp coa product. The results of the study clearly indicated the prevalence of variants in coa gene of S. aureus within as well as between different samples from which they were isolated. Hence, coa gene polymorphism may be used as an easy tool for typing of S. aureus.


Keywords : S. aureus Coagulase Gene Polymorphism Chicken Pork

Introduction

S. aureus is considered as one of the major pathogen responsible for a variety of skin infection and is a commensal bacterium in skin and nasal cavity of both human and animals. The virulence of S. aureus in causing infection has been attributed to several factors and one such factor is coagulase which is produced by majority of the strains and this has been used as a criterion for identification of S. aureus in laboratory. The production of coagulase is encoded by coa gene and amplification of this gene has been considered a simple and accurate method for typing S. aureusisolated from distinct sources (Aarestrup et al., 1994 and Goh et al., 1992). Several researchers have reported polymorphism in coa gene of S. aureus isolated from bovine mastitis and have appreciated the use coa typing as simple and accurate method (Su et al., 1999 and Tenover et al., 1994). Van Belkum et al. (1998) opined that the discriminatory power of coa gene in typing of S. aureus is due to heterogeneity of the region containing the 81 bp tandem repeats at the 3′ coding region of the coagulase gene. Hence, the present study was carried out to determine the polymorphism in coagulase gene in S. aureus isolated from retail chicken and pork meat marketed in Chennai.

Materials and Methods

Bacterial Strains and Culture

A total of 94 Staphylococcus aureus isolates consisting of 46 isolates from chicken and 48 isolates from pork marketed in retail outlets of Chennai, isolated and identified by standard protocol were used in this study (ISO standard 6888/1:1999).

Isolation of Bacterial DNA

The bacterial genomic DNA was extracted from 94 isolates of S. aureus using DNA extraction kits (Qiagen) and the primers were custom synthesized.

Polymerase Chain Reaction (PCR)

PCR amplification was performed using DNA and primers as described by Himabindu et al. (2009). The sequence of forward primer used for amplification was 5’CGAGACCAAGATTCAACAAG and the reverse primer was 5’AAAGAAAACCACTCACATCA. PCR conditions used were as follows- 94°C for 5 min, followed by 30 cycles of 95°C for 30 sec, 55°C for 45 sec and 72°C for 2 min, followed by a final extension of 72°C for 7 min. The PCR products were stained with 1% solution of ethidium bromide and visualized under UV light after gel electrophoresis on 2.5% agarose gel.

Results and Discussion

In the present study PCR amplification of chicken and pork isolates by PCR revealed that the sizes of products obtained after amplification ranged from 600- 1000 bp. Similar results have been documented by Himabindu et al. (2009), who opined that the primer designed was based on 3’-end region of the coagulase gene and internal primers for the 3’ end hyper variable region containing 81 bp tandems repeats thus resulting in multiple banding pattern. Coagulase gene amplification of 46 chicken isolates revealed nine different banding patterns (Table 1 and Fig. 1).

Table 1: Coagulase gene polymorphism in S. aureus (n= 46) isolated from chicken meat in retail outlets of Chennai

S. No. coa gene band pattern (bp) No. of Isolates Frequency (%)
1 648 1 2.17
2 723 1 2.17
3 812 4 8.70
4 891 30 65.22
5 913 1 2.17
6 723,891 4 8.70
7 430,891 1 2.17
8 812,891 3 6.52
9 723,812,913 1 2.17
Total 46 100.00

Fig 1: PCR amplification of coa gene revealing polymorphism (9 patterns) of Staphylococcus aureus isolated from chicken

Lane1 & 8: 100 bp marker, Lane 2: Negative control, Lane 3: 648 bp, Lane 4: 723 bp, Lane 5: 812 bp, Lane 6: 891 bp, Lane 7: 913 bp, Lane 9: 430 & 891 bp, Lane 10:723 & 891 bp, Lane 11: 812, 891 bp and Lane 12: 723, 812 & 913 bp.

Thirty seven isolates (80.43 %) showed distinctive single band pattern, of which thirty isolates (65.22 %) amplified 891 bp, 4 (8.70 %) isolates amplified 812 bp, one isolate (2.17 %) amplified 648 bp, one isolate (2.17 %) amplified 723 bp and one isolate (2.17 %) amplified 913 bp. A total of 9 isolates (19.57 %) amplified multiple banding pattern of which 4 isolates (8.70 %) amplified both 723 & 891 bp, 3 isolates (6.52 %) amplified 812 & 891 bp, one isolate (2.17 %) amplified 430 & 891 bp and one isolate (2.17 %) amplified 723, 812 & 913 bp. Majority of the chicken isolates amplified 891 bp coa product. Coagulase gene amplification of 48 pork isolates revealed eleven different electrophoretic patterns (Table 2 and Fig. 2).

Table 2: Coagulase gene polymorphism in S. aureus (n= 48) isolated from pork in retail outlets of Chennai

S. No. coa gene band pattern (bp) No. of Isolates Frequency (%)
1 648 5 10.42
2 723 4 8.33
3 812 2 4.17
4 891 2 4.17
5 420, 648 1 2.08
6 723, 812 9 18.75
7 723, 891 14 29.17
8 420, 891 1 2.08
9 812, 891 4 8.33
10 812, 913 2 4.17
11 648, 723 1 2.08
12 420, 723, 812 3 6.24
Total 48 100.00

Thirteen isolates (27.08 %) showed distinctive single band pattern, of which 5 isolates (10.42 %) amplified 648 bp, 4 (8.33 %) isolates amplified 723 bp, 2 (4.17 %) isolates amplified 812 bp and 2 (4.17 %) isolates amplified 891 bp product. A total of 35 isolates (72.91 %) amplified multiple banding pattern of which 14 isolates (29.17 %) amplified both 723 & 891 bp, 9 isolates (18.75 %) amplified 723 & 812 bp, 4 isolates (8.33 %) amplified 812 & 891 bp, 2 isolates (4.17 %) amplified 812 & 913 bp, one isolate (2.08 %) amplified 420 & 891 bp, one isolate (2.08 %) amplified 648 & 723 bp, one isolate (2.08 %) amplified 420 &648 bp and 3 isolates (6.24 %) amplified 420, 723 & 812 bp. Majority of the pork isolates produced double banding pattern of 723 and 891 bp coa product.

Fig 2: PCR amplification of Coa gene revealing polymorphism (12 patterns) of Staphylococcus aureus isolated from pork

Lane 1, 9 & 16: 100 bp DNA marker, Lane 2: Negative control, Lane 3: 648 bp, Lane 4: 723 bp, Lane 5: 812 bp, Lane 6: 891 bp, Lane 7: 420 & 648 bp, Lane 8: 420 & 891 bp, Lane 10:648 & 723 bp, Lane 11: 723 & 812 bp, Lane 12: 723 & 891 bp, Lane 13: 812 & 891 bp, Lane 14: 812 & 913 bp, Lane 15: 420, 723 & 812 bp.

The results of the present study were in agreement with Gharib et al. (2013) who observed that coa gene had a polymorphic repeat consisting of 81bp tandem short sequence repeats and majority of the S. aureus isolates (80%) produced a single band, with molecular sizes ranging from 648-913 bp as compared to double and triple banding pattern. Similarly, Guler et al. (2005) classified S. aureus isolates into 8 classes and the sizes of the PCR products of coa gene ranged from 350 to 917 bp. Schlegelova et al. (2003) also observed that S. aureus isolated from dairy cow and human amplified PCR products ranging from 650 -1050 bp, and that 730 bp was the most pattern observed among the isolates. Contrary to the findings of our present study, El-Hamid and Bendary (2013) and Abdulghany and Khairy (2014) observed that amplification of coa gene of S. aureus isolates produced 19 and 15 different banding patterns in PCR amplification respectively and the sizes of the products ranged from 410 to 750 bp.

Conclusions

The results of the present study clearly indicated the existence of polymorphism among the S. aureus isolated from retail chicken and pork meat in Chennai. The pattern of polymorphism showed different patterns in both the isolates indicating that the source of contamination might be different and Coa gene polymorphism may be utilized as a tool for early typing of the isolates. However, further characterization of the isolates by high throughput technologies like Mutilocus Sequence Typing (MLST), spa (Protein A) typing and Pulse Field Gel Electrophoresis (PFGE) need to be evaluated, which will provide better insights on the origin of the isolates.

References

  1. Aarestrup FM, Scott NL and Sordillo L.M. 1994. Ability of Staphylococcus aureus coagulase genotypes to resist neutrophil bactericidal activity and phagocytosis. Infect. Immun. 62: 5679-5682.
  2. Abdulghany HM and Khairy RM. 2014. The Frequency of Methicillin-Resistant Staphylococcus aureus and Coagulase Gene Polymorphism in Egypt. Int. J. Bacteriology. 2014: 680983.
  3. El-Hamid MIA and Bendary MM. 2013. Association between agr Alleles and Toxin Gene Profiles of S. aureus Isolates from Human and Animal Sources in Egypt. Int. J. Adv. Res. 1(8): 133-144.
  4. Gharib AA, Attica MAA and Bendary MM. 2013. Detection of the Coa Gene in Staphylococcus aureus from different sources by polymerase chain reaction. Int. J.Microbiol.Res.4 (1): 37–42.
  5. Goh SH, Byrne S, Zhang JL and Chow AW. 1992. Molecular typing of Staphylococcus aureus on the basis of coagulase gene polymorphisms. J. Clin. Microbiol. 30: 1642-1645.
  6. Guler L, Ok U, Gunduz K, Gulcu Y and Hadimli HH. 2005. Antimicrobial susceptibility and coagulase gene typing of Staphylococcus aureus isolated from bovine clinical mastitis cases in Turkey. J. Dairy Sci., 88: 3149-3154.
  7. Himabindu M, Muthamilselvan SD, Bishi DK and Verma RS. 2009. Molecular analysis of coagulase gene polymorphism in clinical isolates of methicillin resistant Staphylococcus aureus by fragment length Polymorphism based genotyping. American Journal of Infectious Diseases. 5(2): 170-176.
  8. ISO 6888-1: 1999. Horizontal methods for enumeration of coagulase positive Staphylococci (Staphylococcus aureus and other species). Part 1: Technique using Baird-Parker agar medium. International Organization for Standardization, Geneva, Switzerland.
  9. Schlegelova J, Dendis M, Benedik J, Babak V and Rysanek D. 2003. Staphylococcus aureus isolates from dairy cows a nd humans on a farm differ in coagulase genotype. Vet. Microbiol. 92: 327-334.
  10. Su C, Herbelin C, Frieze N, Skardova O and Sordillo LM. 1999. Coagulase gene polymorphism of staphylococcus aureus isolates from dairy cattle in different geographical areas. Epidemiol. Infect. 122: 329-336
  11. Tenover FC, Arbeit R, Archer G, Biddle J and Byrne S. 1994. Comparison of traditional and molecular methods of typing isolates of Staphylococcus aureus. J. Clin. Microbiol. 32: 407-415.
  12. Van Belkum A, Scherer S, Van Alphen L and Verbrugh H. 1998. Short-sequence DNA repeats in prokaryotic genomes. Microbiol. Mol. Biol. Rev. 62: 275-293.
Full Text Read : 1718 Downloads : 322
Previous Next

Open Access Policy

Close