NAAS Score 2018

                   5.36

Declaration Format

Please download declaration format and submit along with manuscript.

Submit News Items

You can submit news items via contact us

Symposium

conference

Seminar

Summer/Winter School

Awards

Flag Counter

Previous Next

Comparative Expression Analysis of Porcine Beta-Defensin-1 Gene between Large White Yorkshire and Ankamali Pigs

Pruthviraj D. R. Venkatachalapathy R. T. Usha A. P. Pramod S. Pragathi K. S. Karthikeyan A.
Vol 8(4), 71-80
DOI- http://dx.doi.org/10.5455/ijlr.20171113013154

The porcine beta defensin-1 (PBD-1) gene encodes an antimicrobial peptide active against several bacteria and fungi. Ankamali pigs are indigenous to Kerala with unique qualities like disease resistance and adaptation to tropics. The Large White Yorkshire (LWY) is the most widely distributed breed of pig in the world. A study was undertaken to compare the expression profile of PBD-1 gene in different tissues of Ankamali and LWY pigs using quantitative real time polymerase chain reaction (qPCR) employing SYBR green chemistry. Relative quantification was performed by comparative Ct method. A significant difference (P<0.01) was observed in the expression of PBD-1 gene among the different tissues studied. Expression of PBD-1 mRNA was high in tongue and oral epithelia compared to the intestinal tissue, in both the breeds. Further, expression of PBD-1 mRNA was slightly higher in tissues of Ankamali pigs compared to LWY pigs. However, the difference was statistically not significant.


Keywords : Gene Expression Large White Yorkshire and Ankamali Pigs Porcine Beta Defensin-1 Gene

Pork is the most commonly consumed meat in the world. In India, pork is highly preferred in the states of Kerala and the North East. This emphasises the scope for pig farming in India. Disease occurrence is a major threat to pig. Occurrences of disease cause high morbidity and mortality resulting in huge loss to farmers. Native pig breeds show better adaptability to local environment and are considered to have better disease resistance (De et al., 2013). However, due to their lower productive performance, farmers prefer to rear exotic pig breeds or their crosses in many developing countries including India. Therefore, there is a need to evaluate disease resistance capability of high productive exotic breeds under tropical conditions.

A comparative analysis of expression levels of genes responsible for immunity between the native and exotic breeds would be a useful step in above mentioned evaluation. It has been understood that the mammalian immune system protects the host from invading pathogenic microorganism initially by innate immunity and subsequently by acquired immunity. Innate immune system is endowed with a variety of antimicrobial molecules to defend the host against various microorganisms (Kindt et al., 2007). One such important molecules are antimicrobial peptides (AMPs) which are polypeptide molecules made up of less than 100 amino acid residues (Ganz, 2003). Based on the net charge present, AMPs are broadly classified into anionic and cationic peptides (Hancock, 1997).

Among the cationic peptides, defensins are a subclass which possesses broad spectrum antimicrobial activity against various bacteria, fungi and viruses. They have six to eight highly conserved cysteine residues that form intra-molecular disulphide bonds, based on this, three families of defensins are defined viz. α-, β- and θ-defensins (Lai and Gallo, 2009). The β-defensins are secreted at higher levels in the epithelial surfaces and are found to be associated with mucosal immunity (Weinberg et al., 1998). The peptide encoded by porcine β-defensin-1 (PBD-1) gene is shown to be active against Escherichia coli, Salmonella typhimurium, Listeria monocytogenes, Staphylococcus aureus and Candida albicans (Shi et al., 1999; Jiang et al., 2006; Li et al., 2013). The expression of β-defensin genes in human, cattle and poultry has been associated with several disease conditions such as Crohn’s disease, HIV infection, oral lesions, mastitis and salmonellosis (Bagnicka et al., 2007; Hasenstein and Lamont, 2007; Baroncelli et al., 2008).

Comparative studies on expression levels of β-defensin genes in different breeds of pigs would aid in understanding their regulation at the level of transcription. Therefore, the present investigation was undertaken as a pilot study to evaluate if there was any difference in the expression levels of PBD-1 gene among the native and exotic breeds of pigs.

                                                                                         

Materials and Methods

Experimental Animals

Six adult Ankamali pigs and six adult Large White Yorkshire (LWY) pigs reared at Centre for Pig Production and Research, Mannuthy, Thrissur, Kerala, India were selected for the experiment.

Collection of Tissue Samples

Tissue samples from tongue, oral mucosa and intestine (duodenum) were collected immediately after sacrificing the animal. Sections of the tissues (about 0.5 cm length and width, <0.1 cm thickness) weighing ~200 mg were taken using a sterile Baird-Parker (BP) blade with gloved hands and were immersed quickly into 1 ml RNA later solution (Sigma Aldrich).

Extraction of RNA

Total RNA was isolated from each tissue sample using TRI reagent (Sigma Aldrich) as per the protocol suggested by the manufacturer. About 100 mg of RNAlater stabilised tissue was used for isolation using 1 ml TRI reagent. Tissue homogenization was performed for 90 seconds with the help of a polytron homogeniser (IKA T10 basic ULTRA-TURRAX Homogenizer system). The concentration of RNA was measured in a NanoDrop™ 2000c spectrophotometer (ThermoScientific) and integrity was assessed by 2% denaturing agarose gel electrophoresis.

DNase Treatment and cDNA Synthesis

Deoxyribonuclease (DNase) treatment of RNA samples was performed to remove potential genomic DNA contamination with a commercially available DNase (DNase I, Amplification Grade, Sigma Aldrich) following manufacturer’s directions. Complementary DNA (cDNA) was synthesised from 1 µg of DNase treated RNA using Revert Aid first strand cDNA synthesis kit (Thermo Scientific, K1622). A 100 pM/µl random hexamer primers were used for real time amplification. The reactions were set up in 0.2 ml RNase free PCR tubes with following thermal cycler conditions: 5 min at 25 °C, 60 min at 42 °C and 5 min at 70 °C. Resultant cDNA was stored at -20 °C until further use.

Quantitative Real Time PCR

Quantitative real time PCR was performed in a 48-well Eco™ Real-Time PCR System (Illumina, USA). The cDNA was used as template for real time amplification of reference gene, Ribosomal protein L4 (RPL4) and the target gene, PBD-1. RPL4 gene was selected as the reference gene based on its stability in the present study and in previous studies as well (Nygard et al., 2007; Pierzchała et al., 2010; Rebouças et al., 2013). Primers to amplify PBD-1 and RPL4 (Table 1) were adopted from published reports of Qi et al. (2009) and Nygard et al. (2007), respectively. The SYBR green chemistry was used for generation of fluorescent signal and a passive reference dye, ROX was used to eliminate pipetting inaccuracies and fluorescence fluctuations. Separate qPCR reactions were set up for PBD-1 and RPL4 genes. For each 12.5 μl qPCR reaction, 1.0 μl cDNA, 1.0 μl forward primer (10 pM), 1.0 μl reverse primer (10 pM), 6.25 μl Maxima SYBR Green qPCR Master Mix (Thermo Scientific) and 3.25 μl nuclease water were mixed together. Each sample was amplified in triplicate. The cyclic conditions for real-time PCR were: initial denaturation at 95 °C for 10 minutes, 40 cycles with a 30 denaturation step at 95 °C, followed by a 55 °C annealing step for 15 s and a 72 °C extension step for 30 s. Data acquisition was performed after extension step of each cycle and the purity of the amplification was analysed using melting curves. Six biological replicates (6 LWY and 6 Ankamali pigs) of each tissue were used for relative quantification and each tissue sample was amplified in triplicate (technical replicates). In addition, a no template control (NTC) for each gene to check for primer-dimer, reverse transcription minus (RT minus) control for each sample to check for genomic DNA contamination and a negative control (nuclease free water) were included in every plate.

Table 1: Parameters and sequences of primers for qPCR

S. No. Primer Name Primer Sequence (5’-3’) Length GC (%) Tm (°C) Product size (bp)
1 PBD-1 QRT F TCCTTGTATTCCTCCTCA 18 44.4 55.4 93
2 PBD-1 QRT R ACACGCCTTTATTCCTTA 18 38.8 54.7
3 RPL4 F CAAGAGTAACTACAACCTTC 20 40 50.4 122
4 RPL4 R GAACTCTACGATGAATCTTC 20 40 52.7

Statistical Analysis

Statistical analysis was performed using SPSS Version 20. The F-test (one-way ANOVA) and the independent samples t-test were done to compare the PBD-1 gene expression among three tissues and two breeds, respectively. The results were considered significantly different at 5% level of significance.

Results and Discussion

Concentration, Purity and Quality of RNA

The mean concentration of RNA was 506 ng/μl with a OD260/OD280 ratio of 2.06. The integrity of extracted RNA was verified by resolving the RNA samples in 1.2 % (W/V) agarose gel (Fig.1). The 28S and 18S rRNA bands were clear and intensity of the 28S rRNA band was almost twice that of the 18S rRNA indicating good quality RNA. The mRNA was observed as smear spanning between 28S and 18S rRNA. The absence of band near the well indicated the purity of RNA sample from genomic DNA contamination.

 

Fig. 1: Total RNA isolated from different tissues of Ankamali and LWY pigs.

Lane 1-3: Intestine, Oral epithelia and Tongue samples of Ankamali pigs.

Lane 4-6: Tongue, Oral epithelia and Intestine of LWY pigs.

qPCR Amplification of PBD-1 and RPL4 Genes

Initially, the PBD-1 and RPL4 genes were amplified from cDNA using conventional PCR. The PCR conditions were standardised for different concentrations of primers and annealing temperatures. Results visualized in 4% (W/V) agarose gel showed clear bands at expected position (Fig. 2).

Fig. 2: PCR amplification of 122 bp fragment of RPL4 gene and 93 bp fragment of PBD-1 gene from cDNA.

Lane 1-5: 122 bp PCR product of RPL4 gene.

Lane 6-10: 93 bp PCR product of PBD-1 gene.

Lane M: 50 bp DNA marker.

These optimised PCR conditions were transferred on to the Eco™ Real-Time PCR System (Illumina) for carrying out qPCR. Real-time amplification of the target gene and the reference gene fragments were reliable and consistent. A melt curve analysis performed at the end of the reaction for checking specificity of amplification showed a single peak each for PBD-1 and RPL4 genes with a melting temperature (Tm) value of 75.4 and 79.0 °C, respectively (Fig. 3). However, Qi et al. (2009) had reported a Tm value of 81 °C for PBD-1 gene in a study on Tibetan and crossbred pigs.

Fig.3: Melt curves generated during real-time qPCR assay for PBD-1 (blue curves) and RPL4 (brown curves) genes.

qPCR Efficiencies of PBD-1 and RPL4 Genes

The qPCR efficiency was determined using the slope of the standard curves generated from serial dilution of cDNA samples (Stahlberg et al., 2003). The cDNA of all the representative tissue samples were pooled to prepare “Stock I solution” and it was used in serial dilution (Grubor et al., 2004; Gallup and Ackermann, 2008). Serial dilution experiments showed that the slope of standard curve for the PBD-1 gene was -3.3 and that of the RPL4 gene was -3.5. This corresponds to an efficiency of 2.01 and 1.93 for PBD-1 and RPL4, respectively. Though the ideal theoretical value of the slope of a standard curve is -3.32 (2.00 efficiency), slopes ranging from -3.1 to -3.6 (efficiency of 1.9 to 2.1) are generally considered acceptable (Taylor et al., 2011). The R2value which measures linearity of the standard curve was > 0.99 for both the assays. A R2 value of one is ideal and a value above >0.985 is considered acceptable (Logan et al., 2009). As both the genes had acceptable levels of qPCR amplification efficiencies, 2-∆∆CT method was used to calculate the relative expression of PBD-1 gene.

Relative Expression of PBD-1 Gene in Different Tissues

In both the breeds of pigs, PBD-1 gene was expressed at significantly higher levels in tongue and oral epithelia compared to the intestine. In Ankamali pigs, relative expression of PBD-1 mRNA was 14583 folds higher (P<0.01) in tongue followed by 1163 folds (P<0.01) in oral epithelia compared to the intestine (Fig. 4a). Similarly, in LWY pigs, expression of PBD-1 mRNA was 13931 folds higher (P<0.01) in tongue and 395 folds (P<0.01) in oral epithelia compared to the intestine (Fig. 4b). Higher expression of PBD-1 mRNA in the oral cavity of pig has been reported by Zhang et al. (1998) and Veldhuizen et al. (2007). Similar high level of expression of PBD-1 was also reported in the oral cavity of different Tibetan and Chinese breeds of pigs (Qi et al., 2009 and Chen et al., 2010).

Fig. 4: PBD-1 mRNA tissue distribution in a) Ankamali and b) LWY pigs. Values are depicted as relative expression in number of folds compared to the intestine (n=5). Bars with different superscripts differ significantly (P<0.01).

Veldhuizen et al. (2007) had found that the expression of PBD-1 mRNA in tongue was 7000 folds higher compared to jejunum. Qi et al. (2009) had reported higher expression of PBD-1 mRNA by 7569 and 7105 folds respectively in tongue and oral epithelia of crossbred pigs compared to their intestine. They have also found that the fold difference was 30508 and 8855 folds respectively in the tongue and oral epithelia of Tibetan pigs compared to their intestine. This result is also consistent with the expression pattern described in other livestock species such as sheep (Huttner et al., 1998), goat (Zhao et al., 1999), cattle (Stolzenberg et al., 1997) and poultry (Zhao et al., 2001).These findings clearly indicate the higher expression of PBD-1 gene in the oral cavity of pigs. It has been established that the peptide encoded by this gene has antimicrobial action against several bacteria and fungi (Shi et al., 1999; Jiang et al., 2006; Li et al., 2013). The present investigations also provide conclusive evidence on the involvement of the PBD-1 peptide in the co-creation of an antimicrobial barrier in the oral cavity of pigs and its definitive role in its innate immunity.

 

Relative Expression of PBD-1 Gene in Different Breeds

The PBD-1 mRNA was slightly upregulated in Ankamali pigs compared to LWY pigs in all the three tissues studied. However, the independent samples t-test could not establish any statistical significance (Fig. 5). The relative expression of PBD-1 mRNA was found to be 1.21 folds higher in tongue, 3.41 folds higher in oral epithelia and 1.16 folds higher in intestine of Ankamali pigs compared to that of LWY pigs.

 

Fig. 5: Relative expression of PBD-1 mRNA in a) Tongue b) Oral mucosa and c) Intestinal tissues of Ankamali and LWY pigs. Values are depicted as relative expression in number of folds compared to respective tissues of LWY breed from five independent experiments

Similar levels of expression might probably be attributed to the adaptation of LWY line to the tropical climate over three decades of their introduction. Several other factors might also have contributed towards the adaptation of exotic pigs, which needs further verification. These results are in contrast with the findings of other researchers where higher expression of PBD-1 was noticed in the native breeds. Significantly higher expression of PBD-1 gene was reported in Tibetan (Qi et al., 2009) and Chinese Meishan pigs (Chen et al., 2010) compared to the crossbred pigs.

Conclusion

In conclusion, gene expression studies clearly indicated higher expression of PBD-1 gene in the oral cavity of pigs. Considering the antimicrobial activity of PBD-1 peptide, it can be stated that this gene is involved in the co-creation of an antimicrobial barrier in the oral cavity of pigs and plays a definitive role in its innate immunity. There was no significant difference in the expression levels of PBD-1 mRNA in Ankamali and LWY pig breeds which might probably be suggesting adaptation of LWY line to the tropical climate which needs further genome wide validation including larger number of samples.

Acknowledgements

Authors are grateful to Kerala Veterinary and Animal Sciences University for providing the facilities for the conduct of the research.

References

  1. Bagnicka, E., Strzałkowska, N., Flisikowski, K., Szreder, T., Jóźwik, A., Prusak, B., Krzyżewski, J. and Zwierzchowski, .L. 2007. The polymorphism in the b4-defensin gene and its assotiation with production and somatic cell count in Holstein-Friesian cows. Anim. Breed. Genet.124: 150–156.
  2. Baroncelli, S., Ricci, E., Andreotti, M., Guidotti, G., Germano, P., Marazzi, M.C., Vella, S., Palombi, L., De Rossi, A. and Giuliano, M. 2008. Single-nucleotide polymorphisms in human beta-defensin-1 gene in Mozambican HIV-1-infected women and correlation with virologic parameters.AIDS.22: 1515–1517.
  3. Chen, J., Qi, S., Guo, R., Yu, B. and Chen, D. 2010. Different messenger RNA expression for the antimicrobial peptides beta-defensins between Meishan and crossbred pigs. Mol. Biol. Rep. 37:1633-–1639.
  4. De, A. K., Jeyakumar, S., Kundu, A., Kundu, M. S., Sunder, J. and Ramachandran, M. 2013. Genetic characterization of Andaman Desi pig, an indigenous pig germplasm of Andaman and Nicobar group of islands, India by microsatellite markers. Wld. 6(10): 750-753.
  5. Gallup, J.M. and Ackermann, M.R. 2008. The ‘PREXCEL-Q Method’ for qPCR. Int. J. Biomed. Sci. 4(4): 273–293.
  6. Ganz, T. 2003. The role of antimicrobial peptides in innate immunity Comp. Biol. 43:300-304.
  7. Grubor, B., Gallup, J.M., Meyerholz, D.K., Crouch, E.C., Evans, R.B., Brogden, K.A., Lehmkuhl, H.D. and Ackermann, M.R. 2004. Enhanced Surfactant Protein and Defensin mRNA Levels and Reduced Viral Replication during Parainfluenza Virus Type 3 Pneumonia in Neonatal Lambs. Clin.Diagnostic Lab. Immunol. 11(3): 599–607.
  8. Hancock, R.E.W. 1997. Peptide antibiotics. Lancet. 349: 418-–422.
  9. Hasenstein, J.R. and Lamont, S.J. 2007. Chicken gallinacin gene cluster associated with Salmonella response in advanced intercross line. Avian Dis. 51: 561–567.
  10. Huttner, K.M., Bresinski-Caliguri, D.J., Mahoney, M.M. and Diamond, G. 1998. Antimicrobial peptide expression is developmentally regulated in the ovine gastrointenstinal tract. Nutr. 128: 297S–299S.
  11. Jiang, L.H., Lu, H.R., Huang, D.X., Yi, J.B., Li, L.Y. and Lin, F. 2006. Expression of porcine beta-defensin-1 gene in Pichia pastoris. Sheng Wu Gong Cheng XueBao.22: 1036–1039.
  12. Kindt, T. J., Goldsby, R. A., Osborne, B. A., & Kuby, J. 2007. Kuby immunology. New York: W.H. Freeman.
  13. Lai, Y. and Gallo, R.L. 2009. AMPed up immunity: how antimicrobial peptides have multiple roles in immune defense. Trends Immunol. 30: 131-141.
  14. Li, C., Xu, T., Chen, R., Huang, X., Zhao, Y., Bao, Y., Zhao, W. and Zheng, Z. 2013. Cloning, expression and characterization of antimicrobial porcine β-defensin-1 in Escherichia coli.Protein Expression and Purification. 88: 47–53.
  15. Logan, J.M.J., Edwards, K.J. and Saunders, N.A. (2009). Real-time PCR: Current Technology and Applications. Horizon Scientific Press, Norfolk, 123p.
  16. Nygard, A., Jørgensen, C.B., Cirera, S. and Fredholm, M. 2007. Selection of reference genes for gene expression studies in pig tissues using SYBR green qPCR. BMC Mol. Biol. 8: 67-77.
  17. Pierzchała, M., Pareek, C.S., Urbański, P., Goluch, D., Kamyczek, M., Różycki, M. and Kurył, J. 2011. Selection of reference genes for gene expression studies in porcine hepatic tissue using quantitative real-time polymerase chain reaction. Sci. Papers Rep. 29 (1): 53-63.
  18. , S, Chen, J., Guo, R., Yu, B. and Chen, D. 2009. β-defensins gene expression in tissues of the crossbred and Tibetan pigs. Livestock Sci. 123:161-168.
  19. Rebouças1, E.L., Costa, J.J.N., Passos, M.J., Passos,J.R.S., Hurk, R., and Silva, J.R.V. 2013. Real time PCR and importance of housekeepings genes for normalization and quantification of mrna expression in different tissues. Brazilian Arch. Biol. Tech. 56(1): 143-154.
  20. Shi, J., Zhang, G., Wu, H., Ross, C.R., Blecha, F. and Ganz, T. 1999. Porcine epithelial beta-defensin-1 is expressed in the dorsal tongue at antimicrobial concentrations. Immun. 67: 3121‑3127.
  21. Stahlberg, A., Aman, P., Ridell, B., Mostad, P. and Kubista, M. 2003. Quantitative real-time PCR method for detection of B-lymphocyte monoclonality by comparison of kappa and lambda immunoglobulin light chain expression, Chem. 49: 51–59.
  22. Stolzenberg, E.D., Anderson, G.M., Ackermann, M.R., Whitlock, R.H. and Zasloff, M. 1997. Epithelial antibiotic induced in states of disease. Natl. Acad. Sci. USA. 94: 8686–8690.
  23. Taylor, S., Wakem, M., Dijkman, G., Alsarraj, M. and Nguyen, M. (2011). A practical approach to RT-qPCR – Publishing data that conform to the MIQE guidelines. Bulletin 5859, Bio-Rad Laboratories Inc. Irvine, CA. pp 1-8.
  24. Veldhuizen, E.J.A., van Dijk, A., Tersteeg, M.H.G., Kalkhove, S.I.C., van der Meulen, J., Niewold, T.A., Haagsman, H.P. 2007. Expression of beta defensins pBD-1 and pBD-2 along the small intestinal tract of the pig: lack of upregulation in vivo upon Salmonella typhimurium infection. Immunol. 44: 276–283.
  25. Weinberg, A., Krisanaprakornkit, S. and Dale, B.A. 1998. Epithelial Antimicrobial Peptides: Review and Significance for Oral Applications. Rev. Oral Biol. Med .9(4): 399-414.
  26. Zhang, G., Wu, H., Shi, J., Ganz, T. and Ross, C.R. 1998. Molecular cloning and tissue expression of porcine β-defensin-1. FEBS Lett. 424: 37-40.
  27. Zhao, C., Nguyen, T., Liu, L., Shamova, O., Brodgen, K. and Lehrer, R.I. 1999. Differential expression of Caprine beta-defensin in digestive and respiratory tissues. Immun. 67: 6221‑6224.
  28. Zhao, C., Nguyen, T., Liu, L., Sacco, R.E., Brodgen, K.A. and Lehrer, R.I. 2001. Gallinacin-3, an inducible epithelial beta-defensin in the chicken. Immun. 69: 2684–2691.
Abstract Read : 86 Downloads : 20
Previous Next
Book Promotion

Submit Jobs

You can submit Jobs (JRF/SRF/Others relevant) via contact us This will help to find right talent.

Close