Introduction

The yak (Bos grunniens) is a unique and multi-purpose domestic animal of high mountain areas of the Himalaya. Yak grazes on natural highland pasture. Yaks have adapted well in high altitude life due to anatomical and physiological advantages that help them, which includes large lungs and hearts, lack of hypoxic pulmonary vasoconstriction Dolt et al. (2007), strong environmental sense and high energy metabolism Wang et al. (2011). Domestic Indian yaks provide the basic resources, such as meat, milk, hides, down hair, fuel, draught power and transportation that are necessary for nomadic pastoralists in high-altitude environments Wiener et al. (2003).  There are a number of different phenotypic types among Indian yak. The “common” yak resembles medium size hill cattle in body conformation. The yak-rearing states of India are Arunachal Pradesh, Sikkim, Uttar Pradesh, Himachal Pradesh and Jammu and Kashmir. The states bordering the southern slopes of the Himalayas have a cold, humid climate, while Himachal Pradesh and Jammu & Kashmir are cold and dry. Hybridization with local cattle is practised only randomly, although the F1 hybrid is generally more productive than either parental species. Yak milk and milk products are widely consumed by herdsman. Yak milk products like cheese, butter etc, fills an important niche in lifestyle and is a resource for livelihood of the nomadic people. In the last few years, milk of non-traditional dairy animals like donkey, camel, goat and yak has attracted consumer’s preferences due to good quality and higher percentage of proteins. In recent years research related to yak’s milk and its products composition analysis has attracted interest. High content of β-casein (>45%) and consequently the lower proportion of α-casein (about 40%) together with a small increase in κ-casein make the milk more favourable for infant and sick people Haimei LI et al. (2010). Jain and Yadava (1985) have described compositional characteristics and amino acid profile of Indian yak milk.

Milk protein secreted by the mammary epithelial cells contains mainly casein and whey proteins. The genotypes of milk protein are controlled by co-dominant genes on chromosome 6 which is of remarkable interest for many researchers searching for quantitative trait loci (QTLs) for milk production traits Ferretti et al. (1990), Hayes et al. (1993) and Popescu et al. (1996). Casein genes polymorphism has been well studied in cattle and goat Rando et al. (2000), Marletta et al. (2007) and Caroli et al. (2009). Bovine milk protein contains 25-30% β casein (209 amino acids) which are part of cluster comprising four casein genes αS1, αS2, β and κ. Beta casein (β-casein) has 13 genetic variants A1, A2, A3, B, C, D, E, F, H1, H2, I, and G out of which A1 and A2 are common and the others are the less common variants Farell et al. (2004) and Roginski et al. (2003). In last few decades, presence of A1 β-casein in milk has been associated with range of illnesses in human beings. A1 β-casein preferentially releases an opioid peptide called BCM-7 (β –casomorphine-7) upon digestion. While the kappa casein plays an essential role in stabilizing casein micelles and sig­nificantly influencing the properties of products manufactured from milk Creamer et al. (1998). Genetic variants of κ-casein have been extensively studied in cattle and 13 alleles have been identified to date Barroso et al. (1998), Prinzenberg et al. (1999) and Gallinat et al. (2013).

The high concentration of total proteins in yak’s milk makes it better than that of the cow’s milk (Bos taurus) and goat’s milk (Capra hircus), while the proportion of individual caseins being relatively similar to those of buffalo (Bubalus bubalis) and ewe (Ovis aries) milk Wiener et al. (2003) and Li et al. (2010). The present study is focused on the genetic polymorphism of casein protein genes. Milk protein polymorphism serves as an important component of genetic diversity and is helpful in the conservation, exploitation and utilization of animal breeds. This study aimed to identify the genetic polymorphism of β-casein and κ-casein genes in different populations of Indian yaks spread across the states of Jammu & Kashmir, Himachal Pradesh, Sikkim and Arunachal Pradesh.

Materials and Methods

Sample Collection and DNA Isolation

The analysis involved collection of blood samples from the following yak populations present in Indian states of Jammu & Kashmir, Himachal Pradesh, Sikkim and Arunachal Pradesh. We have named population according to state name just to differentiate so far no distinct breed of Yaks is registered in India except Arunachali (INDIA_YAK_2300_ ARUNACHALI _16001). Sample of Ladakhi (n-44), Himachali (n-38), Sikkimi (n-56), and Arunachali (n-36) collected. Blood samples were collected in EDTA vacutainer and stored in deep freezer at −20 °C until the isolation of DNA. The genomic DNA was extracted from 8–10 ml blood samples using the phenol-chloroform method Sambrook et al. (1989). The quality and quantity of isolated DNA were determined using agarose gel electrophoresis (0.8%). To identify candidate gene polymorphism PCR primers were used from reported sources (NCBI) and were also designed using Primer 3 using Genbank published sequences of genes.

PCR Amplification and Sequencing

The coding region of exon 7 (467 bp) of β-casein were successfully amplified using the primers (F5′cttctttccaggatgaagtcc-3′, R5′gacttacaagaatagggaagg3′) reported by Bonifacio et al (2001) and for exon 4 of κ-casein two primer sequences were utilised (κ-CSNF-5′gagaaagatgaaagattcttc-3′, κ-CSNR-5′gcttctggattatctacagtg-3′) and (ExIVF – 5′agaaataataccattctgcat3′, ExIVR – 5′ gttgaattctttgatgtctccttagagt3′) to amplify a fragment in the expected size (about 550 bp) in yak population as described by Prinzenberg (1999). Further to check for duplication repeat of 12bp sequence in κ-casein, another pair of primer (169F: 5′-aatccctaccatcaatacc-3′, 169R:5′-ttagaccgcagttgaagta-3′), derived from the yak κ-casein (AY095311) was utilised. Custom DNA sequencing has been done to check polymorphisms. PCR amplification reactions was performed in a total volume of 25 μl containing ~50–100 ng of genomic DNA, 10 pmol of each primer, 200 μM of each dNTP, 2.5 μl of 10X buffer with 1.5mM MgCl2 and 1 U Taq DNA polymerase (Bangalore Genei Pvt. Ltd., Bangalore, India). PCR amplification were performed with thermal cycling conditions of initial denaturation at 95°C for 3min followed by 37 cycles of 94°C for 30s, annealing temperature 55°C for 30s and 72°C for 30s followed by final extension at 72°C for 5min. Amplified product were analyzed using 1%EE Agarose using 1X TAE buffer. Representative samples were sequenced directly using automated DNA sequence. Gene (allele) and genotype frequencies were calculated by simple frequency calculations Falconer and Mackay (1996). The deviation of genotypic frequencies from expectations (Hardy–Weinberg equilibrium) was analyzed using Chi-square test.

Sequence Analysis

The sequence data were edited manually using Chromas Ver 2.6.4. Multiple sequence alignments (MSA) were performed using MegAlign tool of LASERGENE software (DNA STAR, Inc., Madison, WI, USA). Genotype frequencies of single nucleotide polymorphism (SNPs) were determined by direct counting method. The coding sequences of candidate genes were conceptually translated into amino acid sequence using EDITSeq tool of DNASTAR software. Nucleotide BLAST program was used for sequence homology searches from public databases. In addition, the corresponding sequences in Genbank of yak (JN655524, EF565131) and bovine (EF628290, AJ619772) were used to compare the sequence of study region among species.

Results and Discussion

We have studied the genetic polymorphisms of β-casein and κ-casein gene in different yak population across India based on automated DNA sequencing and SNP detection. A fragment of 467 bp exon VII of β-casein gene was sequenced in yak samples and compared with the reference gene sequences. The sequence information obtained by direct sequencing of the PCR products was used to detect SNPs in the studied region of gene and the obtained sequences was also analysed for previously reported alleles in respective genes.

Sequencing revealed a total of five SNPs across the exon VII β-casein gene. Overall 90% (N=4) of the SNPs encountered were transitions changes in this gene. Sequence analysis of the amplified samples of the β-casein gene in Ladakhi samples revealed nucleotide variations at the position g.8093 A>G, g.8261 T>C (Heterozygous) and g.8461 C>T (Heterozygous). Sequence analysis of the amplified samples in Himachali yak population revealed nucleotide variations at the position g.8093 A>G, g.8101 A>C, g.8261 T>C (Heterozygous) and g.8461C>T (Heterozygous). Sikkimi and Arunachali yak population sequencing revealed two nucleotide substitutions at the position g.8261 T>C (transition) and g.8412 C>T (transition). These variations are found to be synonymous in nature as these variations do not result in their corresponding amino acid change. The SNPs loci were in Hardy-Weinberg equilibrium in the yak populations (P>0.05), details are shown in Table 1. As reported in earlier studies casein cluster genes influences milk performance traits in animals, polymorphism occurring within exon VII of β-casein gives rise to A1 and A2 type alleles, which is related to increase in both protein yield and percentage in milk Velmala et al. (1995), Ikonen et al. (1999) (2001), Nilsen et al. (2009), Chessaa et al. (2003) and Oleński et al (2012).

Two different sequences of different length, allele type 1 and type 2, differing by 12-bp sequence duplication was observed after sequencing the PCR product for κ-casein gene in different populations. Sequence length could easily be detected by sequencing.

Table 1: Exon 7 of β-casein gene variants in Indian Yak populations

Sequence 1, allele type 2 with long length is more common in the yak populations investigated in the present study. While the Sikkim population showed the highest frequency of the type 1 variant (short form). These characteristics suggest that natural breeding isolation (physical long distance) occurs between Sikkimi population with other population, and pure breeding as a traditional method is used in the breeding practices of North-Eastern populations. Duplication motif leads 164 amino acid (AA) encoded in the yak type 2 allele, whereas the sequence of yak type 1 had the same length as in cattle, encoding 160 of the 169 AA of mature κ-casein gene. The 12 bp duplication corresponds to the codons for AA 147 to 150 (Glu-Ala-Ser-Pro) or it can frame shift left or right. Moreover multiple repeats were also found, which are repeated identically, Yak κ-casein may exist as several variants due to the presence of AA duplication or as other AA substitutions motif Prinzenberg et al. (2008). Due to amino acid differences the two variants of κ-casein may differ in structure and function thus influencing the milk properties. It has been shown that evolution of these multiple alleles is due to existence of common ancestor Mercier et al. (1976).

Further sequence analysis for SNP detection revealed two SNPs of the κ-casein gene among yak individuals. These SNPs were only observed in Sikkimi yak population which give rise to difference at amino acid position 148 Ala(GCT) to Asp(GAT), Ala at this position appeared to be more pre­dominant in most yak samples. Since the different amino acids (Alanine and Aspartate) at position 148 differ significantly in properties such as charge and molecular weight, there substitution may affect the function of κ-casein gene as well as the derived peptides Malkoski et al. (2001). This substitution effect was previously reported in bovine κ-casein A and B alleles (Genbank accession No. X14908). Another SNP give rise to substitution effect at position 136 from Thr(ACC) to Ile(ATC), identical to bovine κ-casein *A was also observed in yaks, details are shown in Table 2. The effects of casein genetic polymorphisms are important in the animals since it influences the quantitative traits and milk processing properties Ceriotti et al. (2004). Caseins have been   proposed as polymorphic markers for the animal selection in order to improve yield and quality of cheese in goats Bonifacio et al. (2001).

The sequences of exon VII of β-casein and exon IV of κ-casein genes of yak (Bos grunniens) were further subjected to basic local alignment search to know the sequence homology with the corresponding region of other species. Sequences X14908, AF041482, AF123250, AF123251, AF105260, AF121023, AF092513, AJ619772, and AF194989 representing alleles of CSN3 from Genbank were used for local alignment. BLAST (NCBI) analysis with different species revealed homology of 99% with Bos taurus and Bos indicus, 97% with Bubalus bubaline, 95% with Ovis aries, 95% with Capra hircus and 81% with Camelus dromedarius.

Table 2: Frequencies of genotype and allele of κ-casein gene in the different yak populations

A: short length; B: long length with 12-bp nucleotide sequence duplication

Conclusion    

Different yak populations were genotyped for the β-casein and κ-casein locus by allele specific PCR, distributions of all genotypes were in Hardy-Weinberg Equilibrium. A medium genetic diversity and the practice of random mating recorded in the population under study especially in Sikkim yak population. There is genetic variability observed in the casein genes in different yak populations spread across India, although none of these SNPs variability causes difference in translated protein by amino acid change; however they could be in linkage disequilibrium with other functional allelic variants. In Indian domestic yak populations κ-casein gene was found to be polymorphic, at least two yak-specific sequences are present and which can be discriminated by sequence analysis. This could be useful in genetic variation studies within and between yak populations. It is also useful for studying the introgression of cattle genes into domesticated yak population since crossbreeding with cattle is common feature for milk improvement. These results will be useful in future breeding works aimed at identifying possible associations with milk performance traits and could be used as potential markers for milk production.

Acknowledgments

The authors thank the Yak herders of Leh (Ladakh), Spiti (Himachal Pradesh), Thangu (Sikkim) and Mangan (Arunachal Pradesh) for providing blood samples and stay. Support of our colleagues Dr. Firoz Din Sheikh, SKUAST – Kashmir, Leh, Mr. Pashang Bhutia, Sikkim, Dr. Saurabh Deori, ICAR-NRC Yak, Dirang and Mr. Naresh Kumar, ICAR-NBAGR, Karnal is also acknowledged. Authors are grateful to the Director, ICAR-National Bureau of Animal Genetic Resources, Karnal, local administration of Leh, Sikkim and Arunachal Pradesh states for providing logistics and support.

References

1. Barroso, A., Dunner, S., & Canon, J. (1998). Technical note: Detection of bovine kappa-casein variants A, B, C, and E by means of polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP). Anim. Sci. 76: 1535-1538.
2. Bonifacio, C., Santos, I.C., Belo, C., & Cravador, A. (2001). SSCP analysis of alpha S1 casein, b-casein and k-casein genes in Charnequeira Portuguese indigenous goat breed. Zootech. 5, 189–190.
3. Caroli, A.M., Chessa, S., & Erhardt, G.J. (2009). Milk protein genetic variation in cattle: impact on animal breeding and human nutrition. Dairy Sci. 92, 5335–5352.
4. Ceriotti, G., Chessa, S., Bolla, P., Budelli, E., Bianchi, L., Duranti, E., & Caroli, A. (2004). Single nucleotide polymorphisms in the ovine casein genes detected by polymerase chain reaction-single strand conformation polymorphism. Dairy Sci. 87, 2606–2613.
5. Chessa, S., Budelli, E., Gutscher, K., Caroli, A., & Erhard, G. (2003). Short communication: Simultaneous identification of five kappa-casein CSN3 alleles in domesticated goat by polymerase chain reaction single strand conformation polymorphism PCR-SSCP. Dairy Sci. 86, 3726–3729.
6. Creamer, L.K., Plowman, J.E., Liddell, M.J., Smith, M.H., et al (1998). Micelle stability: kappa-casein structure and function. Dairy Sci. 81: 3004-3012.
7. Dolt, K.S., et al. (2007). cDNA cloning, gene organization and variant specific expression of HIF-1α in high altitude yak (Bos grunniens). Gene 386, 73–80.
8. Falconer, D.S., & Mackay, T.F.C. (1996). Introduction to Quantitative Genetics, Ed 4. Longmans Green, Harlow, Essex, UK.
9. Farrell, H.M., Jimenez-Flores, R., Bleck, G.T., Brown, E.M., Butler, J.E., Creamer, L.K., Hicks, C.L., Hollar, C.M., Ng-Kwai-Hang, K.F., & Swaisgood, H.E. (2004). Nomenclature of the proteins of cows’ milk–sixth revision. J Dairy Sci. Jun; 87(6):1641-74.
10. Ferretti, L., Leone, P., & Sgaramella, V. (1990). Long range restriction analysis of the bovine casein genes. Nucleic Acids Res. 18, 6829–6833.
11. Gallinat, J.L., Qanbari, S., Drögemüller, C., Pimentel, E.C., et al. (2013). DNA-based identification of novel bovine casein gene variants. Dairy Sci. 96: 699-709.
12. Haimei, L.I., Ying, M.A., Aijun, DONG., Jiaqi, WANG., Qiming, L.I., Shenghua, H.E., & Jean-Louis, MAUBOIS. (2010). Protein composition of yak milk, Dairy Sci. Technol. 90: 111–117.
13. Hayes, H., Petit, E., Bouniol, C., & Popescu, P. (1993). Localization and as2–343 casein gene (CASAS2) to the homologous cattle, sheep and goat chromosomes 4 by in-situ hybridization. Cytogenet. Cell Genet. 64: 281–285.
14. Ikonen, T., Ahlfors, K., Kempe, R., Ojala, M., & Ruottinen, O. (1999). Genetic parameters for themilk coagulation properties and prevalence of non coagulating milk in Finnish dairy cows. Dairy Sci. 82 (1): 205–214.
15. Ikonen, T., Bovenhuis, H., Ojala, M., Ruottinen, O., & Georges, M. (2001). Associations between casein haplotypes and first lactation milk production traits in Finnish Ayrshire cows. Dairy Sci. 84 (2), 507–514.
16. Jain, Y.C., & Yadava, R.S., (1985). Yield and composition of milk of Himachali yak, yak hybrid and hill cow. Indian J. Sci. 55:223- 224.
17. Karamjit, S., Manoj, K. Mishra., Jayashree, Karar., Masroor, A. Baig., Zakwan, Ahmed., & Pasha. M.A.  (2007). cDNA cloning, gene organization and variant specific expression of HIF-1αin high altitude yak (Bos grunniens). Gene 386: 73–80.
18. Kawamoto, Y., Namikawa, T., Adachi, A., Amano, T., Shotake, T., Nishida, T., Hayashi, Y., Kattel, B., & Rajubhadary, H.B, (1992). A population genetic study on yaks, cattle and their hybrids in Nepal using milk protein variations. Sci. J. 63:563–575.
19. Li, H.M., Ma, Y., Dong, A.J., Wang, J.Q., Li, Q.M., He, S.H., & Maubois, J.L. (2010). Protein composition of yak milk. Dairy Sci. Technol. 90: 111–117.
20. Malkoski, M., Dashper, S.G., O’Brien-Simpson, N.M., Talbo, G.H., Macris, M., Cross, K.J., & Reynolds, E.C. (2001). Kappacin, a Novel Antibacterial Peptide from Bovine Milk. Antimicrobial Agents and Chemotherapy, 45(8), 2309–2315.
21. Marletta, D., Criscione, A., Bordonaro, S., Guastella, A.M., & D’Urso, G., (2007). Casein polymorphism in goat’s milk. Lait 87: 491–504.
22. Mercier, J.C., Chobert, J.M., & Addeo, F. (1976). Comparative study of the amino acid sequences of the casein macropeptides from seven species. FEBS Lett. 72:208–214.
23. Nilsen, H., Olsen, H.G., Hayes, B., Sehested, E., Svendsen, M., Nome, T., Meuwissen, T., & Lien, S. (2009). Casein haplotypes and their association with milk production traits in Norwegian Red cattle. Sel. Evol. 41, 24.
24. Oleński, K., Cieslinska, A., Suchocki, T., Szyda, J., & Kaminski, S. (2012). Polymorphismin coding and regulatory sequences of beta-casein gene is associated with milk production traits in Holstein-Friesian cattle. Sci. Paper Rep. 30 (1), 5–12.
25. Popescu, P., Long, S., Riggs, P., Womack, J., Schmutz, S., Fries, R., & Gallagher, D.S. (1996). Standardization of cattle karyotype nomenclature: report of committee for standardization of the cattle karyotype. Cell Genet. 74, 259–261.
26. Prinzenberg, E.M., Jianlin, H., & Erhardt, G. (2008). Genetic variation in the kappa-casein gene (CSN3) of Chinese yak (Bos grunniens) and phylogenetic analysis of CSN3 sequences in the genus J. Dairy Sci. 91: 1198-1203.
27. Prinzenberg, E.M., Krause, I., & Erhardt, G. (1999). SSCP analysis at the bovine CSN3 locus discriminates six alleles corresponding to known protein variants (A, B, C, E, F, G) and three new DNA polymorphisms (H, I, A1). Biotechnol. 10: 49-62.
28. Rando, A., Ramunno, L., & Masina, P. (2000). Mutations in casein genes. Nutr. Anim. 26, 105–114.
29. Ritz, L.R., Glowatzki, Mullis, M.L., MacHugh, D.E., & Gaillard, C. (2000). Phylogenetic analysis of the tribe Bovini using microsatellites. Genet. 31:178–185.
30. Roginski, H. (2003). Encyclopedia of dairy sciences. Academic Press, London.
31. Sambrook, J., Frotsch, E.F., & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual. II^nd Cold Spring Harbour, Cold Spring Laboratory Press, NY.
32. Shao, B., Long, R., Ding, Y., Wang, J., Ding, L., & Wang, H. (2010). Morphological adaptations of yak (Bos grunniens) tongue to the foraging environment of the Qinghai-Tibetan Plateau.  Anim. Sci.88, 2594–2603.
33. Velmala, R., Vilkki, J., Elo, K., & Mäki-Tanila, A. (1995). Casein haplotypes and their association with milk production traits in the Finnish Ayrshire cattle. Anim. Genet. 26, 419–425.
34. Wang, H., Long, R., Liang, J. B., Guo, X., Ding, L., & Shang, Z. (2011).Comparison of nitrogen metabolism in Yak (Bos grunniens) and indigenous cattle (Bos taurus) on the Qinghai-Tibetan Plateau. Asian-Aust. J. Anim. Sci.24, 766–773.
35. Wiener, G., Han, J.L., & Long, R.J., The Yak 2nd edn. (2003), Food and Agriculture Organization of the United Nations, Publication.