NAAS Score 2018

                   5.36

Declaration Format

Please download DeclarationForm and submit along with manuscript.

UserOnline

Free counters!

Previous Next

Detection and Characterization of Arcobacter Species from Milk and Milk Products Procured From Anand City, Gujarat

Shivani Modi Yogesh A. Chatur
Vol 8(3), 59-69
DOI- http://dx.doi.org/10.5455/ijlr.20171005053150

Recent identification of Arcobacter spp. from human cases has raised the concern about prevalence of Arcobacter in food of animal origin and characterization of virulence potential. This study was undertaken to investigate the presence of Arcobacter spp. in milk and milk products and characterization by 16S rRNA sequencing. A total of 120 milk samples (50 cow and 70 buffalo milk) and 20 milk products (10 paneer and 10 cheeses) were collected from the different collection points in Anand city. The samples were processed by microbiological culture and further confirmed by species specific PCR with reported primers. Arcobacter spp. were detected in 24 (20%) raw milk samples whereas none of the milk product were found positive. Among 120 raw milk samples 18 (15%) and 6 (5%) were positive for Arcobacter butzleri and A. cryaerophilus, respectively. A. butzleri was significantly predominant in cow milk (22%) than buffalo milk (10%). Phylogenetic study of 16S rRNA sequences of A. cryaerophilus revealed high variability and our isolate find 98% similarity with representative A. cryaerophilus sequence (Accession No.: U34387.1). The presence of Arcobacter in milk confirms that raw milk consumption is a significant risk factor for human beings and it needs to explore the virulence potential of this emerging pathogen.


Keywords : Arcobacter Butzleri Cryaerophilus PCR 16S rRNA Sequencing Skirrowii

Introduction

The significance of food borne pathogens depends upon virulence potential, epidemiology and types of animal husbandry practices followed. Dairy farms are the main source of food borne pathogens because milk obtained from these farms is the main component of diet for human being (Oliver et al., 2009) and if it is consumed raw or used for product preparations, it may be hazardous (Studahl and Andersson, 2000; Neimann et al., 2003; Nachamkin, 2007; Serranio et al., 2013b). In case of newly emerging pathogens understanding the epidemiology of organism plays major role for interventions. Arcobacter has emerged as one of the enteropathogens or potential zoonotic agents in recent years (Ho et al., 2006; Snelling et al., 2006).

The genus Arcobacter belongs to the family Campylobacteriaceae under the epsilon subdivision of the Proteobacteria (Levican et al., 2012) with 18 species (Kayman et al., 2012). In 1977, Ellis and coworkers first isolated the Arcobacter from aborted bovine fetuses and later from porcine fetuses. Due to ability to grow in the presence of air, the name aerotolerant Campylobacter were given by Neill et al. (1980) and finally in 1991, genus name ‘Arcobacter’ was recommended (Vandamme et al., 1991). In animals, Arcobacter spp. has been associated with abortions, mastitis and gastrointestinal disorders (Anderson et al., 1993; Schroeder-Tucker et al., 1996; Bath et al., 2013). In human, it causes acute watery diarrhoea, abdominal cramps, sometime vomition and fever (Vandamme et al., 1992; Lerner et al., 1994; Fernandez et al., 2004; Samie et al., 2007; Houf et al., 2008). Moreover, chronic diarrhoea has also been reported (Wybo et al., 2004). Extra intestinal infections like bacteremia, haematogenous pneumonia and peritonitis have been associated with Arcobacters (Hsueh et al., 1997; Yap et al., 2013). Diarrhoea caused by Arcobacter displays similar morphological and clinical features like Campylobacter jejuni and significantly associated with persistent and watery diarrhoea rather than bloody diarrhoea. Recently, a severe case of persistent diarrhoea associated with Arcobacter cryaerophilus was attributed to Campylobacter spp. in Spain (Figueras et al., 2014).

Arcobacter spp. are one of the main food and waterborne pathogens (Giacommetie et al., 2015,Phillips, 2001; Lehner et al., 2005; Gonzalez et al., 2007; Gugliandolo et al., 2008; Miller et al., 2009; Lappi et al., 2013). It has been isolated and characterized from different foods of animal origin, such as beef, pork, chicken, milk, turkey meat, duck meat and rabbit meat (Rivas et al., 2004; Collado et al., 2009; Amare et al., 2011; Shah et al., 2011, 2012a, 2012b; Douidah et al., 2012; Suelam, 2012 and Ramees et al., 2014). Dairy industries as one of the most organized and practiced industry in Gujarat (India) therefore, we focused on detection and characterization of Arcobacter spp. in raw milk and milk products.

Materials and Methods

A total of 140 samples comprising raw milk (70 buffalo and 50 cow milk), cheese (10) and paneer (10) were collected from different collection points, retail shops and vendors in and around the Anand city in sterilized screw cap bottles on ice pack and processed within 2 hours for cultural isolation of Arcobacter species. The isolation was performed as described by Shah et al. but we used the Preston broth instead of Arcobacter enrichment broth (Shah et al., 2011). Primarily, the pH of milk was adjusted to 7.5, homogenized properly; and 20 ml of milk sample was centrifuged in sterile centrifuge tubes at 15,000 rpm for 15 min. The supernatant and fat layer was discarded. Pellet obtained after centrifugation was suspended in 90 ml of Preston enrichment broth supplemented with Campylobacter Selective Supplement (CAT) (Cefoperazone, Amphotericin B, Teicoplanin) (HiMedia, Mumbai, India) and 7% defibrinated sheep blood in 100ml sterile screw cap flask. Inoculated broths were incubated at 37°C for 48 hours under microaerophilic condition (85% N2, 10% CO2 and 5% O2) build in CO2 incubator (NUAIRE, Plymouth, MN, USA). In case of milk products, 10 gm of products were homogenized in normal saline and suspended in 90ml Preston enrichment broth as for milk samples at 37°C for 48 hours. Following enrichment of the samples, a membrane filtration technique was used for plating. Briefly, a 47-mm-diameter, 0.65-mm-pore-size cellulose acetate membrane filter was laid on the surface of blood agar base no. 2 incorporated with 5% defibrinated horse blood, and 4 drops) of broth culture were dispensed onto the plates using a sterile Pasteur pipette and incubated at 37°C aerobically for at least 48 h. Small colorless to off-white translucent colonies were selected from each plate and transferred again to blood agar to obtain pure cultures.

Three or four Arcobacter-like colonies were picked from each plate and subjected to Gram staining and oxidase, catalase, indoxyl acetate, hippurate hydrolysis tests and resistance to cefaperazone (On et al., 1996; Atabay and Corry 1997; Kabeya et al., 2003). Presumptively identified Arcobacter isolates were confirmed by species specific PCR and 16S ribosomal sequencing The DNA was extracted by heat and snap chilling method as described earlier. Each isolate was subjected for species specific detection by PCR assay using primers as described by Houf et al. (2000) with certain modifications. The primer sequences for amplification of species specific genes and universal 16S rRNA primers along with the size of target product are tabulated in Table 1.

Table 1: Primers for species specific detection of Arcobacter species and 16S rRNA universal primer

S. No. Primer ID Primer Sequence (5’ 3 ’) Gene Amplification Product Reference
1 Butz_F CCTGGACTTGACATAGTAAGAATGA 16S rRNA 401 bp Houf et al.,2000
Arco_R CGTATTCACCGTAGCATAGC
2 Skrw_F GGCGATTTACTGGAACACA 641 bp
Arco_R CGTATTCACCGTAGCATAGC
3 CryoA1 TGCTGGAGCGGATAGAAGTA 23S rRNA 257 bp
CryoB1 AACAACCTACGTCCTTCGAC
4 8_F AGAGTTTGATCCTGGCTCAG 16S rRNA ~ 1492 bp Lane, 1991
1492_R GGTTACCTTGTTACGACTT

The DNA amplification for each primer pair was carried out in a Applied Biosystems 2720 Thermal Cycler in 25µl solution containing 3µl of DNA template, 12.5µl master mix (Fermentas, USA) (containing 0.05 unit/µl Taq DNA Polymerase, reaction buffer, 4 mM MgCl2, 0.4 mM of each dNTP), 10 pmole of each forward and reverse primer (10pmole/µl), and 7.5 l nuclease free water. The cycling protocol was standardized to set 55oC for both A. skirrowii and A. cryaerophilus the PCR assay as initial denaturation at 95°C for 5 min, followed by 35 cycles of denaturation at 95°C for 45 sec, annealing at 60°C for 45 sec and extension at 72°C for 1 min; and final extension at 72°C for 5 min for A. butzleri whereas annealing temperature was set as. Amplification of the PCR products were detected by electrophoresis in 1.5% agarose gel with ethidium bromide (10µg/ml) in 0.5X TBE buffer (Sigma, USA) at 100 V for 40 min and documented in G:BOXF3 (SynGene, USA).

Confirmation of Isolates by 16S rRNA Sequencing

The direct sequencing of the PCR-generated 16S rRNA gene product was performed as per the method described by Lane et al. (1991). Both strands of the purified PCR products were transferred to the cycle sequencing reaction using universal primer (Table 1) by Sanger’s dideoxy method using Applied Biosystem Big Dye® terminator v3.1 cycle sequencing kit (Applied Biosystems, Foster City, Calif.) as per manufacturer’s recommendations and cycle sequencing products were resolved in ABI 3500 Genetic Analyzer platform.

Analysis of Raw Sequences

The forward and reverse raw sequences were aligned by using SeqScape Software v2.5 against the reference sequences. Complete coding sequences Arcobacter skirrowii 16S ribosomal RNA gene (Accession no. NR_044625.1) was used as the reference sequences for analysis. The aligned sequences were submitted in NCBI nucleotide database using Sequin v12.91 program.

Phylogenetic Analysis

The consensus 16S rRNA sequences of Arcobacter spp. of our study were compared with the representative sequences available in NCBI nucleotide database using Molecular Evolutionary and Genetic Analysis Software version 6.0 (Tamura et al., 2013). The sequences were aligned by ClustalW software build in MEGA 6.0 and the phylogenetic tree was generated by bootstrap method with 1000 replications applying Neighbor-Joining algorithms to a matrix of pair wise distances estimated using the Maximum Composite Likelihood (MCL) approach by complete deletion of gaps and missing data.

Statistical Analysis

The prevalence of Arcobacters in cow and buffalo milk was analyzed by Chi square test using SPSS v.16 software.

Results and Discussion

Small, smooth, translucent, and watery colonies were presumptively identified as Arcobacter. All organisms were gram negative, motile (cork-screw type), positive for oxidase, catalase, and indoxyl acetate hydrolysis, and negative for hippurate hydrolysis. Amplicons of the expected sizes of 257, 401, and 641bp were generated for A. cryaerophilusA. butzleri, and A. skirrowii, respectively during standardization of PCR assay (Fig. 1).

D:\2014\Arcobacter\IJLR\Arcobacter cut copy.jpg

Fig. 1: Agarose gel showing the amplification products of species specific PCR

A) 23S rRNA gene (~257bp) specific for A. cryaerophilus, B) 16S rRNA gene (~401bp) specific for A. butzleri, L1-Low range DNA ladder (100-3000) (Banglore Genei, India), L2-100bp DNA ladder (Fermentas, USA), Lane (A: 1, 2; B: 2,3,5, 9-14): Positive samples, Lane (B: 1, 4, 6, 7 & 8): Negative samples.

Overall, the isolation rate of Arcobacter spp from raw milk was observed to be 20% (24/120) whereas none of milk product was positive for Arcobacter. Among the isolated species, A. butzleri was the most frequently (75%) isolated, followed by A. cryaerophilus (25%), whereas A. skirrowi was not detected from any of the raw milk samples. The distribution of Arcobacter spp. has been tabulated in Table 2.

Table 2: Distribution of Arcobacter spp. experimental samples

Samples No. of Samples Tested Number of Positive Samples
A. butzleri A. skirrowii A. cryaerophilus
Raw cow milk 50 11 (22) 3 (6)
Raw buffalo milk 70 7 (10) 3(4.3)
Cheese 10
Panner 10

A. butzleri was significantly predominant in raw cow milk with 22% (11 of 50 samples) prevalence compared to buffalo milk with 10% (7 of 70 samples) prevalence (p<0.005) whereas no significant difference was observed for prevalence of A. cryaerophilus. The results were in agreement with Revez et al. (2013) and Serranio et al. (2013a) whereas we observed lesser prevalence as compared to Scullion et al. (2006). A lower prevalence was observed by Pianta et al. (2007), Ertas et al. (2010) and Ramees et al. (2014). On the same line, we also observed A. butzleri as most prevalent species (15%) followed by A. cryaerophilus (5%). No Arcobacter spp. was detected from milk products above stated result was in agreement with Khan and Pal, 2011. In case of cheese preparation, the product have been prepared using pasteurized milk otherwise in case of traditional method with unpasteurized milk, organism could not survive at pH 5- 5.5 at the end of ripening unless in higher number (>7 log CFU/ml). Even the cheese conditioning solution could not allow the organism to survive at pH below 3.0 (Giacometti et al., 2013). Serranio et al. (2013b) observed the survival of A. butzleri during production of mozzarella cheese obtained from water buffalo after inoculation of raw milk with A. butzleri and storage at different temperature conditions. The use of raw milk in preparation cheese was suggested as a potential source of Arcobacter infection. Consumption and use of raw or unpasteurized milk is one of the possible route of transmission of Arcobacter spp. to humans and the survivability of Arcobacter in milk have become a public health question as it can grow at pH 5.5-8.0 (D’sa and Harrison, 2005; Serranio et al., 2013b).

Figure2 copy

Fig. 2: Comparative phylogenetic tree of 32 nucleotide sequences by Maximum Likelihood Method. (Phylogenetic tree showing clusters different strains of Arcobacter, Campylobacter and Helicobacter based on 16SrRNA sequences available in NCBI nucleotide database. Analysis was performed based on Tamura-Nei Model (Tamura and Nei, 1993) in MEGA v 6.0 (Tamura et al.,2013). Number at node indicates % similarity of sequences.)

In this study, Arcobacter spp. were isolated from 20% of raw milk sample and no Arcobacter spp. were obtain from paneer and ice-cream whereas Ramees et al. (2014) found lower prevalence of Arcobacter spp. in 3% (3 of 100 samples) of cow milk by PCR. Four isolates (3 A. butzleri and 1 A. cryaerophilus) were characterized by 16S rRNA sequencing. In an attempt to attempt to perform phylogenetic analysis, we observed matching of sequence with respective species sequences (Fig. 2). On species specific phylogenetic analysis of 16S rRNA gene sequence, three A. butzleri isolates revealed 100 % sequence similarity with representative sequence of A. butzleriexcept one (Accession no.: KF690262.1) which was isolated from environmental water sample (Fig. 3A). A. cryaerophilus sequences shown diverse nature. Our isolate sequence (Accession No.: KJ364503.1) matched with 98% similarity with A. cryaerophilus strain sequences (Accession No.: U34387.1) (Fig. 3B) which was isolated from swine gastric samples (Suarez et al., 1997).

D:\2014\Arcobacter\ajmr\Figure 3 and 4 copy.jpg

Fig. 3A and 3B: Phylogenetic analysis of A. butzleri and A. cryaerophilus 16S rRNA sequences by Maximum Likelihood Method.

Fig. 3A shows the homogenous sequences of A. butzleri except A. butzleri (KF690262.1), Bar indicates 2 substitutions per 1000 nucleotides. Fig. 3B shows diverse nature of Arcobacter cryaerophilus but, 99% similarity with A. cryaerophilus (U34387.1) from USA with our isolate, Bar indicates 5 substitutions per 1000 nucleotides. Number at node indicates % similarity of sequences. Analysis was performed based on Tamura-Nei Model (Tamura and Nei, 1993) in MEGA v 6.0 (Tamura et al., 2013).

Conclusion

In this study we revealed that raw milk act as a main source of Arcobacter which is an emerging cause of gastroenteritis in world. The occurrence in human clinical samples, food and undisclosed virulence potential of Arcobacter demands adoption of routine testing and surveillance of this pathogen to evaluate hygienic measures during milking and handling of milk as it is a readily perishable food. Further studies are needed to assess risk factors, modes of transmission, and period of communicability of Arcobacter species in both rural and urban niches to achieve biosecurity. Lastly, though the world has progressed much ahead in diagnosis of wide range of food borne pathogens, but to reduce the occurrence of food borne outbreaks, care of people with farm to fork approach need to be focused in real sense even though newer organism may be identified.

Sequence Submission

16S rRNA sequences of three A. butzleri were submitted in NCBI gene bank database with accession numbers from KJ364500 to KJ364502 whereas one A. cryaerophilus sequence was submitted with accession number KJ364503.

Author’s Contributions

SM and YAC participated in sampling, analysis of samples and sequencing; and made available relevant literatures and carried out statistical analysis. All authors read and approved the final manuscript.

Acknowledgement

We express sincere thanks to Centre of Excellence for Plant Biotechnology, AAU, Anand, Gujarat for providing facility to conduct DNA sequencing at 3500 Genetic analyser platform and Govt. of Gujarat state for providing fund for project.

Conflict of Interest

Authors declare that they don’t have any conflict of interest.

References

  1. Amare LB, Saleha AA, Zunita Z, Jalilam A, Hassan, L. 2011. Prevalence of Arcobacter spp. on chicken meat at retail markets and in farm chickens in Selangor, Malaysia. Food Control, 22(5):732–736.
  2. Anderson KF, Kiehlbauch JA, Anderson DC, McClure HM, Wachsmuth IK. 1993. Arcobacter (Campylobacter) butzleri-associated diarrhoeal illness in a nonhuman primate population. Infection and Immunity. 61: 2220–2223.
  3. Atabay HI, Corry JEL. 1997. The prevalence of Campylobacters and Arcobacters in broiler chickens. Journal of Applied Microbiology. 83:619-626.
  4. Bath GF, Leask R, Pettey KP, Coetzee DJ. 2013. Abortions in sheep associated with Arcobacter skirrowii infection. Journal of South African Veterinary Association. 84(1)
  5. Collado L, Guarro J, Figueras MJ. 2009. Prevalence of Arcobacter in meat and shellfish. J. Food Protect. 72:1102–1106. www.ncbi.nlm.nih.gov/pubmed/19517742
  6. D’sa EM, Harrison MA. 2005. Effect of pH, NaCl content, and temperature on growth and survival of Arcobacter spp. Journal of Food Protection. 68:18-25.
  7. Douidah L, Zutter L, DeBaré J, Vos P, Vandamme P, Vandenberg O, Houf K. 2012. Occurrence of Putative Virulence Genes in Arcobacter Species Isolated from Humans and Animals. Journal of Clinical Microbiology. 50(3): 735–741.
  8. Ellis WA et al. 1977. Isolation of Spirillum/Vibrio-likeorganisms from bovine fetuses. Veterinary Record. 100:4351-452.
  9. Ertas NY, Dogruer Z, Gonulanan A, Ulger I. 2010. Prevalence of Arcobacter species in drinking water, spring water, and raw milk as determined by multiplex PCR. Journal of Food Protection.73:2099–2102.
  10. Fernandez H, Krause S, Villanueva MP. 2004. Arcobacter butzleri an emerging enteropathogen: communication of two cases with chronic diarrhoea. Brazilian Journal of Microbiology. 35: 216–218.
  11. Figueras MJ, Levican A, Pujol I, Ballester F, Quilez MJR., Gomez-Bertomeu F. 2014. A severe case of persistent diarrhoea associated with Arcobacter Cryaerophilus but attributed to Campylobacter spp. and a review of the clinical incidence of Arcobacter spp. New Microbes and New Infections. 2:31–37.
  12. Giacomettia F, Alex L, Antonietta F, Mauro D, Ester G, Ilaria G, Laura S, Gerardo M, Giuseppe M, Andrea S. 2015 Arcobacter butzleri, Arcobacter cryaerophilus, and Arcobacter skirrowii Circulation in a Dairy Farm and Sources of Milk Contamination. Applied and Environmental Microbiology. 18(15): 5055-5063.
  13. Giacometti F, Lucchi A, Manfreda G, Florio D, Zanoni GA, Serraino A. 2013. Occurrence and genetic diversity of Arcobacter butzleri in an artisanal dairy plant in Italy. Applied and Environmental Microbiology. 10: 2404-13.
  14. Gonzalez A, Maria AF, Rosa G, Javier H. 2007. Molecular fingerprinting of Campylobacter and Arcobacter isolated from chicken and water. International journal of Microbiology. 10:85–90.
  15. Gugliandolo C, Irrera GP, Lentini V, Maugeri TL. 2008. Pathogenic Vibrio, Aeromonas and Arcobacter spp. associated with copepods in the straits of Messina (Italy). Marine Pollution Bulletin. 56:600–606.
  16. Ho HT, Lipman LJ, Gaastra W. 2006. Arcobacter, what is known and unknown about a potential foodborne zoonotic agent. Veterinary Microbiology. 115:1-13.
  17. Houf K, Sarah DS, Julie B, Sylvie D. 2008. Dogs as carriers of the emerging pathogen Arcobacter. Journal of Veterinary Microbiology. 130:208– 213.
  18. Houf K, Tutenel A, De Zutter L, Hoof JV, Vandamme P. 2000. Development of a multiplex PCR assay for the simultaneous detection and identification of Arcobacter butzleri, Arcobacter cryaerophilus and Arcobacter skirrowii. FEMS Microbiology Letter.193:89–94.
  19. Hsueh PR, Teng LJ, Yang PC, Wang SK, Chang SC, Ho SW, Hsieh WC, Luh KT. 1997. Bacteremia caused by Arcobacter cryaerophilus. Journal of Clinical Microbiology. 35:489–491.
  20. Kabeya H, Maruyama S, Morita Y, Kuba M, Yamamoto K, Arai S, Izumi T, Kobayashi Y, katsube Y, Mikami T. 2003. Distribution of Arcobacter species among livestocks in Japan. Veterinary Microbiology. 93:153-158.
  21. Kayman T, Abay S, Hizlisoy H, Atabay HI, Diker KS, Aydin F. 2012. Emerging pathogen Arcobacter spp. in acute gastroenteritis: molecular identification, antibiotic susceptibilities and genotyping of the isolated arcobacters. Journal of Medical Microbiology. 61:1439 –1444.
  22. Khan SU, Pal MA. 2011. Paneer production: A review. Journal of Food Science andTechnology48(6):645–660.
  23. Lane DJ. 1991. 16S/23S rRNA sequencing. In E. Stackebrandt, and M. Goodfellow (ed.), Nucleic acid techniques in bacterial systematics. John Wiley & Sons, Chichester, United Kingdom, p. 115-175.
  24. Lappi VArcher JRCebelinski ELeano FBesser JMKlos RFMedus CSmith KEFitzgerald CDavis JP. 2013. An outbreak of foodborne illness among attendees of a wedding reception in Wisconsin likely caused by Arcobacter butzleri. Foodborne Pathogen Diseases.  10(3): 250-255.
  25. Lehner A, Tasara T, Stephan R. 2005. Relevant aspects of Arcobacter spp. as potential foodborne pathogen. International Journal of Food Microbiology. 102:127–135.
  26. Lerner J, Brumberger V, Preac-Mursic V. 1994. Severe diarrhoea associated with Arcobacter butzleri. European Journal of Clinical Microbiology & Infectious Diseases. 13:660–662.
  27. Levican ACollado LFigueras MJ. 2012. Arcobacter cloacae sp. nov. and Arcobacter suis sp. nov., two new species isolated from food and sewage. Systematic and Applied Microbiology. 36(1):22-7.
  28. Miller WG, Wesley IV, On SLW, Houf K, Megraud F, Wang G, Yee E, Srijan A, Mason CJ 2009. First multi-locussequence typing scheme for Arcobacter spp. BioMed Central Microbiology.14:196.
  29. Nachamkin I. 2007. Campylobacter jejuni. Pages 237–248 in Food Microbiology: Fundamentals and Frontiers. 3rd ed. M. P. Doyle and L. R. Beuchat, ed. ASM Press,Washington, DC.
  30. Neill SD, O’Brien JJ and Ellis WA. 1980. Isolation of aerotolerant Campylobacter. Veterinary Record. 106:152–153.
  31. Neimann J, Engberg J, Molbak K, Wegener HC. 2003. A case-control study of risk factors for sporadic Campylobacter infections in Denmark. Epidemiology and Infection. 130:353–366.
  32. Oliver SP, Boor KJ, Murphy SC, Murphy SC, Murinda SE. 2009. Food safety hazards associated with consumption of raw milk. Foodborne Pathogen and Diseases. 6:793–806.
  33. On SLW, Holmes B, Sackin MJ. 1996. A probability matrix for the identification of Campylobacters, Helicobacters and allied taxa. Journal of Applied Bacteriology. 81:425-432.
  34. Phillips CA. 2001. Arcobacter spp. in food: isolation, identification and control. Trends in Food Science and Technology. 12:263–275.
  35. Pianta C, Passos DT, Hepp D, de Oliveira SJ (2007). Isolation of Arcobacter spp. from the milk of dairy cows in Brazil. Ciencia Rural. 37:171–174. www.scielo.br/scielo.php?pid=S0103-84782007000100027&script
  36. Prouet-Mauleon V, Labadi L, Bouges N, Menard A, Megraud F. 2006. Arcobacter butzleri: underestimated enteropathogen. Emerging Infectious Diseases. 12:307–309.
  37. Ramees DP, Rathore RS, Bagalkot PS, Venkatappa HM, Kumar A, Dhama K. 2014. Detection of Arcobacter butzleri and Arcobacter cryaerophilus in Clinical Samples of Humans and Foods of Animal Origin by Cultural and Multiplex PCR Based Methods. Asian Journal of Animal and Veterinary Advances. 9: 243-252.
  38. Revez J, Huuskonen M, Ruusunen M, Lindström M, Hänninen ML. 2013. Arcobacter species and their pulsed field gel electrophoresis genotypes in finnish raw milk during summer 2011. Journal of Food Protection. 76 (9): 1630.
  39. Rivas L, Fegan N, Vanderlinde P. 2004. Isolation and characterization of Arcobacter butzleri from meat. International Journal of Food Microbiology. 91:31–41.
  40. Samie A, Obi CL, Barret LJ, Powell SM, Guerrant RL. 2007. Prevalence of Campylobacter species, Helicobacter pylori and Arcobacter species in stool samples from the Venda region, Limpopo, South Africa: studies using molecular diagnostic methods. Journal of Infectious Diseases. 54:558–566.
  41. Schroeder-Tucker L, Wesley IV, Kiehlbauch JA, Larson DJ, Thomas LA, Erickson GA. 1996. Phenotypic and ribosomal RNA characterization of Arcobacter species isolated from porcine aborted fetuses. Journal of Veterinary Diagnostic Investigation. 8: 86–195.
  42. Scullion R, Harrington CS, Madden RH. 2006. Prevalence of Arcobacter spp. in raw milk and retail raw meats in Northern Ireland. Journal of Food Protection. 69:1986–1990.
  43. Serraino A, Florio D, Giacometti F, Piva S, Mion D, Zanoni RG. 2013a. Presence of Campylobacter and Arcobacter species in in-line milk filters of farms authorized to produce and sell raw milk and of a water buffalo dairy farm in Italy. Journal of dairy science. 96(5): 2801-2807.
  44. Serraino AGiacometti FDaminelli PLosio MNFinazzi GMarchetti GZambriniAVRosmini R. 2013b. Survival of Arcobacter butzleri during production and storage of artisan water buffalo mozzarella cheese. Foodborne Pathogen Diseases. 10(9):820-4.
  45. Shah AH, Saleha AA, Murugaiyah M, Zunita Z, Memon AA. 2012b. Prevalence and distribution of Arcobacter spp. in raw milk and retail raw beef. Journal of Food Protection. 75:1474–1478.
  46. Shah AH, Saleha AA, Zunita Z, Cheah YK, Murugaiyah M, Korejo NA. 2012a. Genetic characterization of Arcobacter isolates from various sources. Veterinary Microbiology.160(3-4):355–61.
  47. Shah,AH, Saleha AA, Zunita Z, Murugaiyah M. 2011. Arcobacter—an emerging threat to animals and animal origin food products? Trends Food Science Technology. 22:225–236.
  48. Snelling WJ, Matsuda M, Moore JE, Dooley JS. 2006. Under the microscope: Arcobacter. Letters in Applied Microbiology. 42:7-14.
  49. Studahl A, Andersson Y. 2000. Risk factors for indigenous Campylobacter infection: A Swedish case-control study. Epidemiology and Infection. 125:269–275.
  50. Suarez DLWesley IVLarson DJ. 1997. Detection of Arcobacter species in gastric samples from swine. Veterinary Microbiology. 57(4): 325-336.
  51. Suelam IIA. 2012. Isolation and Identification of Arcobacter Species Recovered from Rabbits in Zagazig, Egypt. International Journal of Microbiology Research. 3(2):87–92.
  52. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. 2013. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Molecular Biology and Evolution. 30: 2725-2729.
  53. Vandamme P, Falsen E, Rossau R, Hoste B, Segers P, Tygat R, De Ley J. 1991. Revision of Campylobacter, Helicobacter and Wolinella taxonomy: emendation of generic description and proposal for Arcobacter gen. nov. International Journal of Systematic Bacteriology. 41:88–103.
  54. Vandamme P, Pugina P, Benzi G et al. 1992. Outbreak of recurrent abdominal cramps associated with Arcobacter butzleri in an Italian school. Journal of Clinical Microbiology. 30: 2335–2337.
  55. Wybo I, Breynaert J, Lauwers S, Lindenburg F, Houf K. 2004. Isolation of Arcobacter skirrowii from a patient with chronic diarrhoea. Journal of Clinical Microbiology. 42: 1851–1852.
  56. Yap DY, Kwan LP, To KK, Chan TM. 2013. Arcobacter peritonitis after fluoroscopic repositioning of a Tenckhoff catheter. Peritoneal Dialysis International. 33: 222–223.
Abstract Read : 437 Downloads : 98
Previous Next
Close