NAAS Score 2020

                   5.36

UserOnline

Free counters!

Previous Next

Detection and Characterization of Clostridium perfringens in Sea foods

Anusha Naidu Poluru Rajesh Kumar Sahu Krishnaiah Nelapati
Vol 7(7), 177-183
DOI- http://dx.doi.org/10.5455/ijlr.20170513100616

The present study was undertaken to standardize PCR assay for detection of C. perfringens, alpha toxin and enterotoxin from seafood samples collected from selected dams, freshwater lakes, ponds, retail shops and local markets of Telangana State, India and compare with conventional cultural methods. The specificity for C. perfringens, alpha toxin and enterotoxin were tested using primers from 16S rRNA, cpa and cpe genes with 3 Clostridium spp. and 7 other organisms which gave a specific 481, 324 and 233 bp products for C. perfringens, alpha toxin and enterotoxin respectively. The minimum detection level with pure C. perfringens culture was found to be 2.5 CFU/ml. Fluid Thioglycollate broth was superior than Robertson Cooked Meat Broth and 24h incubation was better than 18h. Screening of 300 seafood samples (100 each of fish, crabs and shrimps) revealed that 44 (fish-16, crabs-12, shrimps-16) and 64 (fish-24, crabs-16, shrimps-24) were positive for C. perfringens by cultural and PCR methods, respectively. Out of 64 sea food samples positive for C. perfringens by PCR, 8 (fish-4, crabs-2, shrimps-2) were positive for cpe gene and all PCR positive samples, alpha toxin gene was present. The mean viable counts (CFU/g) are 110, 98 and 102 in fish, crabs and shrimps, respectively.


Keywords : Clostridium perfringens Fishes Crabs Shrimps Cultural method PCR

Introduction

Fish and fish based products easily get spoiled and contaminated by the food borne pathogens particularly bacteria, due to their high perishable characteristic, if not properly stored. When such contaminated foods are consumed either raw or inadequately cooked by human population, there is a detrimental impact on public health. So it requires careful monitoring, especially in the post harvesting storage phase, a critical stage prior to human consumption. Among the food borne pathogens that thrives in high protein and canned food items, Clostridium perfringens always comes foremost. Clostridium perfringens is a gram-positive anaerobic rod-shaped, spore forming bacterium and a natural inhabitant of soil and intestinal tract of humans and many warm blooded animals (Songer, 1996). C. perfringens is one of the most important pathogenic genera implicated in food borne bacterial outbreaks and diseases both in developed and developing countries and constitutes an important public health problem (Miwa et al., 1999). Currently, CPE-producing isolates of C. perfringens are ranked as the second and third most common cause of food borne illness in the U.K. and U.S.A, respectively (Olsen et al., 2000).  It is estimated that it causes nearly a million cases of food borne illness each year. Despite global improvements in public health facilities, a marked increase in C. perfringens food poisoning has been reported in many countries including the European Union (Nahed et al., 2013). C. perfringenss is an important pathogen of human gastrointestinal (GI) tract diseases such as food poisoning, antibiotic-associated diarrhea, and sporadic diarrhea as well as nosocomial diarrheal disease outbreaks (Kobayashi, 2009). C. perfringens is classified into five types (A–E) on the basis of their ability to produce major lethal toxins (alpha, beta, epsilon and iota) (Katayama et al., 1996, Miclard et al., 2009). Alpha toxin encoded by cpa gene causes gas gangrene. A minority C. perfringensproduce enterotoxin that is responsible for food poisoning (diarrhea). Beta toxin is mostly associated with Pigbel in humans (Tweten, 2001). Epsilon toxin causes fatal enterotoxemias in animals, classified as a category B potential bioweapon.

Although the presence of this organism has been reported in different foods, it is mainly a concern for the meat industry because of its predilection for amino acids in meats (Boyd et al., 1948). In the past 10 years the incidence of C. perfringens has increased dramatically (Endale et al., 2013). The number of C. perfringens, to be swallowed in order to cause infection is >105 (Susan et al.,1986) and this number will be achieved by multiplication in foods during storage so long period storage of processed foods before serving might be the primary cause for this food poisoning (Elham and Nahla, 2011).The detection of C. perfringens in foods is problematic due to presence of fewer number of organisms and injured organisms by different food processing methods (Novak and Juneja, 2002). The conventional culture method, which is routinely used for isolation of C. perfringens is time consuming, laborious and may not be suitable for viable but non culturable (VBNC) state of the organisms (Kaneko et. al., 2011). Recent molecular techniques such as PCR offer rapid, reliable and able to detect VBNC state.

Materials and Methods

Three hundred samples of fishes, crabs and shrimps (100 each) collected aseptically from various dams, freshwater lakes, ponds, retail shops and markets of Telangana State were collected in a regular consumer packages and immediately transported to the laboratory in an ice chest. About 10 g of sample was inoculated into 90 ml Fluid Thioglycollate broth (FTG) and Robertson Cooked Meat broths (RCM) and incubated at 37oC for 18h and 24h under anaerobiosis in McIntosh and Fields jars. The enriched inoculum from the broths was streaked onto different selective agar plates like Tryptose Sulphite Cycloserine (TSC) agar, Shahidi Ferguson Perfringens (SFP) agar and Sulfite-Polymyxin-Sulfadiazine (SPS) agars and incubated at 370C for 24 h. Black colored colonies were observed on these agars which were picked up and subjected to biochemical tests. TSC agar was used for counting of number of organisms present (per gram) in the samples (Hauschild and Hilsheimer, 1974).

PCR Assay

The primers used targeting 16S-rRNA for detection of Clostridium perfringens, whereas cpa, and cpe genes were targeted for the detection of alpha toxin and enterotoxin, respectively (Tonooka et al., 2005). They were custom synthesized by integrated DNA technologies (IDT) and are given in Table 1.

Table 1: Details of primers used in this study

Target Gene Primer Length Primer Sequence Amplification Product (bp) Reference
16S rRNA ClPer-1 18 TAACCTGCCTCATAGAGT 481 Tonooka et al., 2005
ClPer-2 19 TTTCACATCCCACTTAATC
cpa Cpa-F 20 GCTAATGTTACTGCCGTTGA 324 Das and Jain, 2012
Cpa- R 20 CCTCTGATACATCGTGTAAG
cpe Cpe-F 20 GGAGATGGTTGGATATTAGG 233 Lin and Labbe, 2003
Cpe-R 19 GGACCAGCAGTTGTAGATA

PCR amplification of the 16S rRNA, cpa, and cpe gene fragments was set up to 20 µl reactions. The PCR protocol was initially standardized by optimizing the concentration of the components of the reaction mixture in the PCR assay and by varying the annealing temperature and cycling conditions. The components of the reaction mix were finally optimized as given in Table 2.

Table 2: Components of reaction mixture

S. No. Name of the Reagent Quantity (μl)
1. 10X Taq polymerase buffer 2.0
2. dNTP mix 0.8
3. Primer-F 2.0
4. Primer-R 2.0
5. Taq DNA polymerase 0.5
6. Purified DNA /Bacterial lysate 2.0

The master mix was made up to 20 µl using molecular grade water. Routinely, master mix was set up and 18 µl each was distributed to the PCR tubes, to which 2 µl of the template was added. In this study, the template preparation was done throughout the experiment by heat lysis application. PCR assay was performed in Eppendorf gradient Thermal Cycler with a heated lid. The cycling conditions used are given in Table 3. PCR products were stored at -20oC until further use.

Table 3: Cycling conditions used for three sets of primers

S. No. Step 16S rRNA (C.perfringens) cpa(alpha toxin) cpe (enterotoxin)
1. Initial denaturation 94oC/2min 95oC/5min 94oC/3min
2. Final denaturation 94oC/30sec 94oC/1min 94oC/30sec
3. Annealing 56oC/30sec 53oC/1min 55oC/1min
4. Initial extension 72oC/1min 72oC/1min 72oC/45sec
5. Final extension 72oC/2min 72oC/10min 72oC/5min
6. Hold 4oC 4oC 4oC

2 µl of the bacterial lysate or purified DNA, 2 µl of 10x assay buffer for Taq polymerase containing 1.5 mM MgCl2, 0.8 µl of 10 mM dNTP mix, 2 µl each of forward and reverse primer (10 pmol/µl) and 1U/μl of Taq DNA polymerase, which was made up to 20 µl using molecular grade water. Routinely, master mix was set up and 18 µl, each was distributed to the PCR tubes, to which 2 µl of the template was added.

Results and Discussion

Fluid Thioglycollate broth was superior to Robertson Cooked Meat broth and 24h incubation was better than 18h. The mean viable counts (CFU/g) are 110, 98 and 102 in fish, crabs and shrimps, respectively. The incidence of C. perfringens and its toxins was presented in Table 4.

Table 4: Cultural and PCR results of different environmental samples for C. perfringens and enterotoxin gene

Positive Result for C. perfringens Positive Samples for cpe gene
Type of sample No. of samples Cultural method PCR assay % of cultural method compared to PCR No. positive by PCR % over total no. of samples % over C. perfringens positive samples
No. % No. %
Fish 100 16 16 24 24 66.66 4 4 16.66
Crab 100 12 12 16 16 75 2 2 12.5
Shrimp 100 16 16 24 24 66.66 2 2 8.33
Total 300 44 44 64 64 68.75 12 8 18.75

Out of 100 fish samples, 16 (16%) were positive for C. perfringens by cultural method and 24 (24%) by PCR method. Out of 24 PCR positives, 4 were positive for enterotoxin by PCR, which accounts to 4 and 16.66% over total no. of samples and positive samples for C. perfringens by PCR, respectively. The incidence of C. perfringens in fish by cultural method in the present study was 16 per cent which is higher than the incidence (6%) reported by Endale et al., 2013, slightly less than the incidence (18.36 %) reported by Das and Jain (2012). Higher incidence (28, 30 and 59.6%) was reported by Lin and Labbe (2003), Wen and McClane (2004) and El-Shorbagy et al.,2012 respectively. Zero incidence of cpe gene was reported by Lin and Labbe (2003), Das and Jain (2012) and Endale et al., 2013, whereas the incidence in the present study was 4 per cent which is less than the incidence (8.8%) reported by Wen and McClane (2004). Twelve (12%) and Sixteen (16%) were positive for C. perfringens out of 100 crab samples, by cultural and PCR methods, respectively. Out of 16 PCR positives, 2 were positive for enterotoxin by PCR, which accounts to 2 and 12.5% over total no. of samples and positive samples for C. perfringens by PCR, respectively. Almost similar results were reported by Miller et al., 2006.

Agarose Gel Electrophoresis of PCR Product of Some C. perfringens Isolates

C:\Users\ANU\Pictures\urgennn.JPG C:\Users\ANU\Pictures\324-------.JPGC:\Users\ANU\Pictures\ramya mam pics\Capture.JPG

Fig.1:Results of fish, crab and shrimp samples for C. perfringens

Lane M: 100 bp DNA Ladder

Lane 1,2: Fish samples showing positive results

Lane 3,5: Crab samples showing positive results

Lane 6,7: Shrimp samples showing positive results

Lane 4,8: negative controls

Fig.2:Results of fish, crab and shrimp samples for alpha toxin

Lane M: 100 bp DNA Ladder

Lane 1,2: Fish samples showing positive results

Lane 3,4: Crab samples showing positive results

Lane 7,8: Shrimp samples showing positive results

Lane 5,6: negative controls

Fig.3:Results of fish, crab and shrimp samples for enterotoxin

Lane M: 100 bp DNA Ladder

Lane 1: Fish samples showing positive results

Lane 3: Crab samples showing positive results

Lane 4: Shrimp samples showing positive results

Lane 2,5,6,7: negative controls

Out of 100 shrimps samples 16 (16%) and 24 (24%) were positive for C. perfringens by cultural and PCR methods, respectively. Out of 16 PCR positives, 2 were positive for enterotoxin by PCR, which accounts to 2 and 8% over total no. of samples and positive samples for C. perfringens by PCR, respectively. The incidence of C. perfringens by cultural method in the present study was 16 per cent which is slightly less than the incidence (17%) reported by Wen and McClane (2004). The incidence of cpe gene in the present study is 2 percent; however zero percent incidences were reported by Wen and McClane (2004).

CONCLUSION SHOULD BE IN PARAGRAPH, PLEASE ADD

The incidence of C. perfringens and its toxins alarms practice of good hygienic measures during handling and storage of aquatic foods. Otherwise, presence of its toxin poses health problems.

References

  1. Boyd, M.J., Logan, M.A. and Tytell, A.A. (1948). The growth requirements of C. perfringens BP6K. J. Biol. Chem., 174:1013-1025.
  2. Das, A. and Jain, A. (2012). Clostridium perfringens type A from fresh water fishes. Int. J. Adv. Biotechnol. Res., 3 (3): 680-687.
  3. El-Shorbagy, M.M., Reda, L.M. and Mona, H. (2012). Prevalence of Clostridium perfringens alpha toxin in processed and unprocessed fish. Int.J.3(3):195-199.
  4. Elham I.A. and Nahla A.A. (2011). Incidence of Clostridium perfringens in meat products at some Egyptian Governorates. Intl. J. Microbiol. Res., 2(3):196-203.
  5. Endale, B.G., Razzbuddin, A.H., Proboth, B. and Acinto, G.B. (2013). Presence of enterotoxigenic Clostridium perfringens in foods of animal origin, Guwahati, India. J. Environ. Occup. Sci., 2(1): 45-50.
  6. Hauschild, A.H.W. and Hilsheimer, R. (1974). Evaluation and modifications of media for enumeration of Clostridium perfringensAppl. Microbiol.27(1): 78-82.
  7. Kaneko, I., Miyamoto, K., Mimura, K., Yumine, N., Utsunomiya, H., Akimoto, S. and McClane, B. A. (2011). Detection of enterotoxigenic Clostridium perfringens in meat samples by using molecular methods. Appl. Environ. Microbiol.77(21): 7526-7532.
  8. Katayama, S., Dupuy, B., Daube, G., China, B. and Cole, S.T. (1996). Genome mapping of Clostridium perfringens strains with I-CeuI shows many virulence genes to be plasmid-borne. Mol. Gen., 251(6):720-726.
  9. Kobayashi, S. (2009). Spread of a large plasmid carrying the cpe gene and the tcp locus amongst Clostridium perfringens isolates from nosocomial outbreaks and sporadic cases of gastroenteritis in a geriatric hospital. Epidemiol. Infect., 137:108–113.
  10. Lin, Y.T. and Labbe, R. (2003). Enterotoxigenicity and genetic relatedness of Clostridium perfringens isolates from retail foods in the United States.  Appl. Env. Microbiol., 69(3): 1642-1646.
  11. Miclard, J., Jañggi, M., Sutter, E., Wyder, M., Grabscheid, B. and Posthaus, H. (2009). Clostridium perfringens beta-toxin targets endothelial cells in necrotizing enteritis in piglets. Vet. Microbiol., 137: 320-325.
  12. Miller, W.A., Gardner, I.A., Atwill, E.R., Byrne, B.A., Jang, S. and Conrad, P.A. (2006).Salmonella spp., Vibrio spp., Clostridium perfringens, and Plesiomonas shigelloides in marine and freshwater invertebrates from coastal California ecosystems. Microbiol. Ecol.52(2): 198-206.
  13. Miwa, N., Masudaa, T., Teraia, K., Kawamuraa, A., Otani, K. and Miyamoto, H. (1999). Bacteriological investigation of an outbreak of Clostridium perfringens food poisoning caused by Japanese food without animal protein. Intl. J. Food Microbiol., 49:103-106.
  14. Olsen, S.J., MacKinnon, L.C., Goulding, J.S., Bean, N.H. and Slutsker, L. (2000). Surveillance for foodborne-disease outbreaks–United States, (1993-1997). MMWR CDC Surveill. Summ., 49:1-62.
  15. Nahed, H.G., Reda, W.W., Darwish, S.F., and Hamza, D.A. (2013). Characterization of Clostridium perfringens Enterotoxin in Food Animals and Human. National disease surveillance center. (2004). Annual Report 2013.
  16. Novak, J.S. and Juneja, V.K. (2002). Clostridium perfringens: Hazards in new generation foods. Inno. Food. Sci. Emer. Tech.3(2): 127-132.
  17. Songer, J.G. (1996). Clostridial enteric diseases of domestic animals. Clin. Microbiol. Reviews. 9(2): 216- 234.
  18. Susan, G., Jackson, D., Yip, C., Clark, B. and Brodsky, H. (1986). Diagnostic importance of Clostridium perfringens enterotoxin analysis in recurring enteritis among elderly, chronic care psychiartric patients. J.Clin.Microbiol., 23(4):748-751.
  19. Tonooka, T., Sakata, S., Kitahara, M., Hanai, M., Ishizeki, S., Takada, M., Sakamoto, M. and Benno, Y. (2005). Detection and quantification of four species of the genus Clostridium in infant feces. Microbiol. Immun.49(11): 987-992.
  20. Tweten, R.K. (2001). Clostridium perfringens beta toxin and Clostridium septicum alpha toxin: their mechanisms and possible role in pathogenesis. Vet.Microbiol., 82(1):1-9.
  21. Wen, Q. and McClane, B.A. (2004). Detection of enterotoxigenic Clostridium perfringens type A isolates in American retail foods. Appl. Environ. Microbiol., 70(5):2685–2691.
Full Text Read : 2035 Downloads : 246
Previous Next

Open Access Policy

Close