NAAS Score 2020

                   5.36

UserOnline

Free counters!

Previous Next

Detection and Isolation of Adenovirus -3 from Cattle in Sudan

Nada Elamein Mohammed Intisar Kamil Saeed Salma Bushra Elmagbool Yahia Hassan Ali Yasir Mehdi Noori
Vol 7(2), 125-134
DOI- http://dx.doi.org/10.5455/ijlr.20170129035700

Respiratory infections are widely occurring in livestock worldwide. This work was done to investigate the role of Bovine adenovirus type 3 (BAV-3) in respiratory infection in cattle in Gezira State. A total of 100 cattle lung tissue specimens showing pneumonic lesions were collected from slaughter houses (Medani and Barakat slaughter houses). Specimens were tested for BAV-3 antigen using direct immunoflourescent antibodies test (FAT) and sandwich ELISA. The overall detected prevalence by both tests was 19 percent. A comparison between the two tests was applied on 40 samples. Trials for virus isolation in Vero cells were applied. One sample was isolated in Vero cells and identified using FAT and PCR.


Keywords : Adenovirus ELISA FAT Virus isolation Sudan

Introduction

Viruses of the Adenoviridae family spread all over the world and infect a wide range of vertebrate(Davison et al., 2003). These have been isolated from wide range of domestic and wild animal species, fishes, amphibians and reptiles (Benko et al., 2002).Bovine adenovirus (BAV) comprises the third largest group of adenoviruses originating from one host species (Ursi et al., 2004), their infections are ubiquitous, easily transmitted and frequently unapparent and cause sometimes–heavy losses in cattle husbandry (Mamadatokhonova, 2006). Similar to other adenoviruses, BAV was reported as a causative agent of respiratory and enteric tract infection (Fent et al., 2002). Bovine adenovirus types 1 and 3 (BAV-1 and BAV-3) are important respiratory pathogens and form acute or sub acute viral diseases in cattle characterized by pyrexia, nasoocular discharge and pneumonia (Akca et al., 2004).

In Sudan, detection and isolation of adenoviruses from calf with pneumonia and enteritis in Khartoum was reported by Eisa (1973), since that time no attempt has been made to study BAV-3 in cattle. However, Intisar et al (2010) reported the first detection of adenovirus type 3 antigen and antibodies in camels. This study is intended to investigate the role of this virus in cattle respiratory disease.

Materials and Methods

Sample Collection

Cattle Lung Tissue Specimens

Pneumonic cattle lungs (n =100) were collected from slaughter houses (23 specimens from Barakat and 77 from Medani in the Gezira State). Collected specimens from apparently healthy animals that passed the clinical examination prior to slaughtering were transferred on ice to the Wad Medani Veterinary Research Laboratory and kept at -20°C until used.

Detection of BAV-3 Antigen

Sandwich ELISA for BAV-3 Antigen Detection

All collected lung tissue samples were examined using ELISA kits for BAV-3 antigen detection, kits were obtained from Bio-X Diagnostics, Jemelle, Belgium. The test was performed according to the instructions of the manufacturer. Approximately 1-gram sample of lung tissue was taken from areas that showed gross lesions and placed in aseptic pestle and mortar with 2-ml of lysis solution supplied with the Kit. Then it was snipped in tiny pieces with a pair of scissors. Homogenzied tissue was transferred to 15-ml sterile test tube and centrifuged at 2000 rpm for 10 minutes, the supernatant was collected in new sterile tube for testing .

Direct Immunofluorescent Technique

A total of 40 lung samples were examined by direct fluorescent antibody technique for the detection of BAV-3 antigen, anti-BAV-3 Fluorescein-labelled conjugate was obtained from Bio-X Diagnostics, Jemelle, Belgium. The test was used to confirm the ELISA results and to identify the isolated viruses in tissue culture.

Impression smears were made from lung tissues in microscopic slides and were left to dry, then the smears were fixed with acetone overnight at -20o C. After drying, one drop of diluted monoclonal antibody fluorescein-labaelled conjugate (1:20) was added to the slide and incubated for 1 hour at room temperature. The slides were washed twice by P.B.S for 5-10 minutes and once in distilled water, then the smears were air dried and mounted in buffered glycerol (glycerol / P.B.S, 9:10), slides were covered with cover slip and tested under fluorescent microscope.

Isolation of BAV-3 in Cell Culture

Three lung tissue specimens tested positive by sandwich ELISA for BAV-3 were inoculated into African green monkey kidney cells (Vero cells). Lung tissue homogenates were prepared (10%) in PBS containing antifungal (Nystatin) and antibiotics (Penicillin-Streptomycin, gentamycine), centrifuged at 1000 g for 10 minutes, after discarding the GMEM media each Flask received 0.3 ml of the supernatant, incubated for 1 hour, then the inoculum was removed and the Flasks were washed by clear GMEM media 3 times then re fed with a non consumed GMEM media, inoculated cell culture Flasks and control were observed daily for the appearance of cytopathological effect (CPE). Three continuous passages were done.

Polymerase Chain Reaction (PCR)

The PCR was used to detect BAV-3 DNA in 4 lung tissue specimens proved positive by ELISA and FAT and to confirm the isolated BAV-3.

BAV-3 DNA Extraction

As described by Ireland and Binepal (1998), 30 µl of the homogenized lung tissue specimens as well as isolated virus was used for the extraction of BAV-3 DNA by boiling in a hot block at 97° C for 13 minutes and quickly chilled in -20° C till used.

Primers

The oligonucleotide primers of BAV-3 (Zakhartchouk et al., 2004) were designed from published sequence of the complete genome (Gen Bank accession No. AF030154) collected from Gen Bank by NCBI Blast and manufactured by Alpha DNA (Montreal Quebec H4C 3N9) in which the predicted product size is 129 bp.

The sequences of the primers were:-

Forward (RTP 1) (19087 to 19106):- 5’– TACAGTAATGTGGCGTTGTA – 3’.

Reverse (RTP 2) (19215 to 19195):- 5’– CGTATCAATAAGGCCGCTAA – 3’.

The PCR cycling program was followed as presented in Table 1.

Table 1: Cycling program for amplification of BAV-3 genome

Step Temperature Time No. cycles
Initial denaturation 94° C 3 min One cycle
Denaturation 94° C 30 sec 35 cycle
Annealing 49° C 30 sec
Extension 72° C 45 sec
Final extension 72° C 5 min One cycle
Final hold 4° C

The PCR products were visualized by gel electrophoresis on a 1.5 % agarose gel stained with ethidium bromide and photographed.

Results

BAV-3 Antigen Detection Using Sandwich ELISA

Out of 100 lung tissue specimens tested for the detection of BAV-3 antigen, 7 were found to be positive (7%), the details are presented in Table 2.

Table 2: Detection of BAV-3 antigen in cattle lung tissue specimens collected from slaughter houses in Gezira state tested by sandwich ELISA

Area Total Lung tissues tested Positive % +ve
Medani 77 5 6.5%
Barakat 23 2 8.69%
Total 100 7 7%

Direct Immunofluorescent Technique

Using FAT, on 40 specimens (7 ELISA positives and 33 ELISA negative specimens) 19 including the 7 ELISA positive and 12 of ELISA negative specimens were found to be positive for BAV-3 antigen (Table 3a and Figure1). According to the intensity of fluorescence specimens showing the three degrees were almost equal (Table 3b).

Isolation and Identification in Vero Cell Line

Three BAV-3 ELISA positive specimens were inoculated into Vero cells. After 2 passages, cytopathic effect (CPE) was noticed, which began 3 days post inoculation and reached more than 80% in 5-7 days post inoculation. The CPE was characterized by rounding and grape-like clustering of infected cells (Figure 2a, 2b). The resulted harvests were found to be positive for BAV-3 when examined by direct fluorescent antibody technique and PCR.

Table 3a: Comparison between sandwich ELISA and FAT for BAV-3 antigen detection in cattle lung tissue specimens

ELISA FAT
Total Negative Positive
19 12 7 Positive
21 21 Negative
40 33 7 Total

Table 3b: Degree of positivity of BAV- 3 antigen in cattle lung tissue specimens tested by direct immunofluorecent technique

Total number of lungs tissue specimens Positive %
40 19 47.5%
+ 6
++ 6
+++ 7

+, ++, +++: Intensity of fluorescence

soba training2 058
Fig 1: Positive cattle lung specimen tested with FAT for BAV-3 antigen detection
Faz153 Picture 010
Fig 2a: Uninfected Vero cells used as control Fig 2b: Cytopathic effect of BAV-3 in Vero cells showing the aggregation of infected cells in shape of grape-like clustering, cells elongation in day 5 post- inoculation.
Fig 3a: Electrophoresis gel for illustrating the PCR amplification for BAV-3 DNA detection, the expected size of the a mplicon is 129 bp

Lane 1 – DNA ladder; Lane 2 – Positive Control; Lane 3-6 – Lung Samples; Lane 7- Negative Control

Fig 3b: Electrophoresis gel of PCR amplification for BAV-3 genome extracted from isolated virus in cell culture, the expected size of the a mplicon is 129 bp

Lane 1 – DNA ladder; Lane 2 – Positive Control; Lane 3 – BAV-3 positive sample; Lane 4 – Negative Control

Detection of BAV-3 genome using (PCR)

Using PCR test, BAV-3 Genome was detected on 4 lung tissue specimens and isolated virus (Figure 3a, 3b). 4 specimens positive by ELISA and FAT were found to be positive by PCR.

Discussion

Bovine adenoviruses are known to exist worldwide, however sparse work was done on this virus in Sudan, the present study was to investigate the existence of this virus and to explore its expected role in respiratory infection in cattle.

In this study, BAV-3 antigens in lung tissue specimens were detected using sandwich ELISA, FAT and PCR.

The detection of BAV-3 in pneumonic lungs of clinically healthy cattle reflects the existence of this virus and its expected role in causation of respiratory infections. The overall detected BAV-3 antigen by ELISA and FAT was (19%) which is considered high, as specimens were collected from clinically healthy animals, this result points to the wide spread of BAV-3 in cattle and draws attention to its role in the causation of respiratory infections which are one of the main constraints of cattle production (Mamadatokhonova, 2006).

Fluorescent antibody test (FAT) for adenovirus antigen in clinical specimens has been widely used in human medicine (Shetty et al., 2003) and reported from veterinary diagnostic laboratories (Mahmoud et al., 2009).Direct immunofluorescence assay was found to be a rapid and inexpensive method for the detection of respiratory viruses (Sadeghi et al., 2011). In this study BAV-3 antigen was detected in 19% of tested specimens, our results agreed with many published work that describe the efficiency of FAT for laboratory diagnosis of BAV.

Alkan (1998) reported that direct immunofluorescence technique was found to be a rapid method for the detection of BAV antigen in nasal swabs and Ceribasi et al. (2014) employed immunofluorescence techniques to investigate the role of BAV-3 and other respiratory viruses in pneumonia cases of cattle in Turkey.

In this study, BAV-3 antigen was detected in some specimens which were negative by ELISA (12) meanwhile all ELISA positives (7) were positive by FAT, this indicated the higher sensitivity of FAT over ELISA in detecting BAV-3 antigen. These results were in agreement with the previous reports using ELISA and FAT for detecting viruses (Corchero et al., 2001, Starik et al., 2001), in contrast, Lauer et al. (1985) and Qiu et al. (2011) stated that ELISA test was more sensitive and highly specific than FAT .

Trials for isolation of BAV-3 from cattle lung tissues were applied in this study using Vero cell line. CPE was observed after 5-7 days characterized by, rounding and grape-like clustering of infected cells, this is in line with the previous reports describing CPE of BAV (Audu et al., 2002), isolated virus was identified using FAT and PCR (Zhu et al., 2011).

Isolation of adenovirus in cell culture has been reported previously in Vero cells (Mejia et al., 2006, Melendez et al., 2009, Norfitriah et al., 2014).

PCR technique was introduced in this study for the first time to detect BAV-3 genome, the technique was found to be sensitive, accurate and rapid tool for the detection of BAV-3 genome, it is recommended to be routinely applied for the laboratory diagnosis of BAV infections.

Detection of adenovirus using PCR was previously reported (De Motes et al ., 2004, Hundesa et al., 2006, Parthiban, et al., 2009, Wong and Xagoraraki, 2010). Ivanics et al. (2010) applied PCR method for detection of adenovirus on different organs (lungs – liver- trachea – intestine) of naturally and experimentally infected goslings to identify egg drop syndrome virus and reported that PCR applied would be sensitive and specific.

Previous studies using different laboratory method for detecting BAV-3 antigen, Stroparo et al(2010) compared antigen detection by indirect immunofluorescence assay (IF), and a specific nested polymerase chain reaction (PCR), in nasopharyngeal aspirates samples collected from patients with acute respiratory disease, 2.6% tested were positive for adenovirus through IF and 10% through PCR, and positive isolation was obtained in 40% and 26% of these cases, respectively. 8% sample were positive for adenovirus tested by rapid immunochromatographic test, meanwhile the ELISA test showed that adenovirus was positive in 9% of the samples collected from patients with gastroenteritis to detect adenovirus antigen among diarrhea cases (Mahmood et al.,2015) .

Conclusion

It was concluded from this study that, BADV-3 is existing in Gezira State; FAT was proved as a rapid method for detection of BAV-3 antigen in lung tissue specimens. PCR appears to be a useful tool for the identification of BAV-3 genome. PCR assay presented here is expected to be a good alternative tool for traditional diagnosis, it was found to be sensitive, specific and rapid method for detection of BAV-3. The PCR technique using the boiling method for DNA extraction is sensitive, cheap and rapid.

Conflict of Interest

None of the authors has any Conflict of Interest.

References

  1. Akca Y, Burgu I, Gür S, Bilge-Dagalp S (2004). A study on investigations of occurrence of some virus infection in Buffaloes in Turkey. Revue de Médecine Vétérinaire, 156: 268-271.
  2. Alkan F (1998). Rapid diagnosis of bovine adenovirus subgroup 1 infection in cattle with acute respiratory disease by direct immunofluorescence technique. Ankara Üniversitesi Veteriner Fakültesi Dergisi, 45: 181-184.
  3. Audu S , Omilabu S A, Peenze I, Steele D A (2002). Isolation and identification of adenovirus recovered from the stool of children with diarrhoea in Lagos, Nigeria. African Journal of Health Sciences, 9:105 -111.
  4. Benko M, Peter E, Ursu K, Ahne W, Lapatra S E, Thomson D, Harrach B (2002). First Molecular Evidence for the Existence of Distinct Fish and Snake Adenoviruses. Journal of Virology, 76: 10056–10059
  5. Ceribasi A O, Ozkaracas M, Ceribasi S, Ozer H (2014). Histopathologic, immunoperoxidase and immunofluorescent examinations on natural cattle pneumonia originated from parainfluenza type 3, Respiratory Syncytial virus, Adenovirus type 3 and Herpesvirus type 1. Revue de Médecine Vétérinaire, 165: 201-212.
  6. Corchero J L, Chun Mar E M, Spira T J, Pellet P E, Inoue N. (2001). Comparison of Serologic Assays for Detection of Antibodies against Human Herpesvirus 8. Clinical and Diagnostic Laboratory Immunology, 8 (5): 913–921.
  7. Davison A J, Benko M, Harrach B (2003). Genetic content and evolution of adenoviruses. Journal of General Virology, 84:2895–2908.
  8. De Motes C M, Casares P C, Hundesa A, Martein M , Girones R (2004). Detection of bovine and porcine adenovirus for tracing the source of fecal contamination. Applied and Environmental Microbiology, 70:1448-1454.
  9. Eisa M (1973). Isolation of bovine adenovirus type 1 in the Sudan. Bulletin of Epizootic Disease of Africa, 21: 411-416.
  10. Fent G M, Fulton R W , Saliki J T, Caseltine S L , Lenmkuhl H D, Confer A W , Purdy C W, Briggs R. E, Loan R , Duff G C (2002). Bovine adenoviruses serotype 7 infections in post weaning calves. American Journal of Veterinary Research, 63: 976-978.
  11. Hundesa A, De Motes C M, Bofill-Mas S, Albinana-Gimenez N, Girones R (2006). Identification of Human and Animal Adenoviruses and Polyomaviruses for Determination of Sources of Fecal Contamination in the Environment Applied and Environmental Microbiology, 72(12): 7886-7893.
  12. Intisar K S, Ali Y H, Khalafalla A I, Taha K M , Mahasin E A Rahman (2010). Adenovirus type 3 infection in camels in Sudan. African Journal of Microbiology Research, 4 (13): 1356-1358.
  13. Ireland D C, Binepal Y S (1998). Improved detection of Capri poxvirus in biopsy samples by PCR. Journal of Virological Methods, 74:1–7.
  14. Ivanics E, Playa V, Glavits R, Dan A, Plafi V, Revesz T, Benko M (2010).The
    1. Role of egg drop syndrome virus in acute respiratory disease of goslings. AvianPathology, 30:201-208.
  15. Lauer B A, Masters HA, Wren C G, Levin M J (1985).Rapid detection of respiratory syncytial virus in nasopharyngeal secretion by enzyme-linked immunosorbent assay ,Journal of Clinical Microbiology ,22 (5) :782-785.
  16. Mahmood D B, Al-suhaill R, Al-Hamdani F G, Salih R A (2015). Detection of
    1. Adenoviruses antigen and its correlation with clinical signs among children with gastroenteritis .Iraqi Journal of Science. 56:1633-1638.
  17. Mahmoud M A, Nahed A Mahmoud, Allam M (2009). Investigations on Infectious Bovine Rhinotracheitis in Egyptian Cattle and Buffaloes, Global Veterinaria 3 (4): 335-340.
  18. Mamadatokhonova G (2006). Detection of adenoviruses in cattle. M.Sc. thesis, Faculty of Veterinary Medicine and Animal Science, Swedish University of Agricultural Sciences.
  19. Mejia L H , Matias F M, Velez M R. (2006).Identification of adenovirus associated with conjunctivitis by molecular methodology, Archivos de la Sociedad Espanola de Oftalmologia,81: 375-382.
  20. Melendez C P, Florentino M M, Martinez,I L, Mejia Lopez H (2009).Outbreak of epidemic keratoconjunctivitis caused by adenovirus in medical residents. Molecular Vision, 15:557-562.
  21. Norfitriah M S , Hair-Bejo M, Omar A R, Aini I ,Nurulfiza M I. (2014). Adaptation and attenuation of fowl adenovirus in Vero cells. Online Journal of Veterinary Research, 18(2):151-166.
  22. Parthiban M, Kumanan K, Sunder K, Kumar S, Kathiresan D (2009). Molecular detection of canine adenovirus using Polymerase Chain Reaction and Sequencing. Tamilnadu Journal of Veterinary & Animal Sciences, 5 (4): 140-142.
  23. Qiu Y, Qian K , Shen H, Jin W , Qinl A (2011). Development and validation of an indirect enzyme-linked immunosorbent assay for the detection of Avian leukosis virus antibodies based on a recombinant capsid protein 23,991:993.
  24. Sadeghi C D, Aebi C, Gorgievski-Hrisoho M, Muhlemann K, Barbani M (2011). Twelve years’ detection of respiratory viruses by immunofluorescence in hospitalised children: impact of the introduction of a new respiratory picornavirus assay. BMC Infectious Disease, 11:41
  25. Sheety A K, Treynor E, Hill D W, Gutierrez K M (2003). Comparison of conventional viral cultures with direct fluorescent antibody stains for diagnosis of community acquired respiratory viruses infection of hospitalized children. Pediatric Infectious Disease Journal, 22(9):789-794.
  26. Starik EGinter ACoppe P (2001). ELISA and direct immunofluorescence test to detect equine arteritis virus (EAV) using a monoclonal antibody directed to the EAV-N protein. Journal of Veterinary Medicine. B,Infectious Disease and Veterinary Public Health, 48(1):1-9.
  27. Stroparo E,Cruz C R,Debur M C,Vidal L R,Nogueira M B, Almedia S M,Pereira L A,Rotta I, Raboni S M(2010).Diagnosis using PCR comparing with antigen detection and culture methodsRev. Inst. Med. Trop. Sao Paulo.52, 317:321.
  28. Ursi K, Harrach B, Matiz K, Benko M (2004). DNA sequencing and analysis of the right-hand part of the genome of the unique bovine adenovirus type 10. Journal of General Virology, 85: 593- 501.
  29. Wong K, Xagoraraki I (2010). Quantitative PCR assays to survey the bovine adenovirus levels in environmental samples. Journal of Applied Microbiology, 109:605–612.
  30. Zakhartchouk A, Connors W, Vankessel A, Tikoo S K (2004). Bovine adenovirus type 3 containing heterologous protein in the C-terminus of minor capsid protein IX .Virology, 320: 291–300.
  31. Zhu Y M, Yu Z M, Cai H, Gao Y R, Dong X M, Li L Z, Shi H F, Meng Q F, Lu ch, Xue F (2011). Isolation, identification and complete genome sequence of bovine adenovirus type 3 from cattle in China. Virology Journal, 8:557.
Full Text Read : 1635 Downloads : 257
Previous Next

Open Access Policy

Close