NAAS Score 2019

                   5.36

Declaration Format

Please download DeclarationForm and submit along with manuscript.

UserOnline

Free counters!

Previous Next

Detection of Polymorphism in Coding Region of SLC11A1 Gene in Jersey Crossbred Cattle

M. Malarmathi N. Murali R. Saravanan P. Gopu L. Gunaseelan
Vol 9(8), 263-267
DOI- http://dx.doi.org/10.5455/ijlr.20190408042208

SLC11A1 gene (Solute Carrier 11 A1 gene), formerly called as Natural Resistance Associated Macrophage Protein 1 (NRAMP1) plays a critical role in innate immunity and mutation of this gene is responsible for susceptibility to a number of intracellular pathogens. The polymerase chain reaction - restricted fragment length polymorphism (PCR-RFLP) analysis (Pst I) of exon 11 in 52 Jersey crossbred cattle revealed presence of three genotypes CC (231bp), CG (231 bp, 200 bp, 31 bp) and GG (200 bp, 31 bp) confirming C > G transversion in coding region. The genotypic frequencies in pooled samples were estimated as 0.24 (CC), 0.48 (CG) and 0.28 (GG). This polymorphism observed in exon 11 is due to single nucleotide polymorphism (C > G). However, no polymorphic pattern was observed in exonic regions 4-5 and 5-6.


Keywords : Jersey Crossbred Cattle NRAMP1 SNP SLC11A1 Transversion

The Nramp1 gene (coding for natural resistance-associated macrophage protein 1), previously known as Lsh/Ity/Bcg and recently renamed as SLC11A1 (solute carrier family 11 member1), was first recognized in mice. The SLC11A1 gene is associated with natural resistance against intracellular pathogens such as Mycobacterium sp., Salmonella sp., and Leishmania. It plays an important role in innate immunity by preventing bacterial growth in macrophages during the initial stages of infection (Paixa`o et al., 2007). In cattle, the SLC11A1 gene sequence was first reported by Feng et al. (1996). Several studies reported possible associations of particular SLC11A1 alleles with susceptibility to Johne’s disease in cattle (Juste et al., 2005) and sheep (Reddacliff et al., 2005). SLC11A1 gene has pleiotropic effects on macrophage function, that include increased chemokine KC, tumor necrosis factor-α, interleukin-1β, nitric oxide synthase and MHC class II expression having significant role in resistance to intracellular pathogens (Awomoyi, 2007).  Furthermore, an association between Crohn’s disease, MAP infection with SLC11A1 gene has been reported (Sechi et al., 2006). Though vaccination helps to prevention and control of diseases in livestock, but it cannot eradicate the diseases. In these circumstances, marker assisted selection and breeding for improving disease resistance in animals can be effective strategy for the control of diseases. The goal of present study is to associate the presence of single nucleotide polymorphism (SNPs) in SLC11A1 gene with Johne’s disease suspected crossbred dairy cattle.

Materials and Methods

A total of 52 blood samples were collected (40 blood samples were JD suspected crossbred cattle and 12 normal crossbred cattle) from Jersey crossbred cattle. Animals were classed as suspected based on symptoms of JD like diarrhea, weakness, weight loss, etc. Genomic DNA was isolated from the venous blood using standard phenol chloroform extraction method by Sambrook et al. (1989). Primers P1, P2 and P3 (Table 1) were used to amplify the exon 4-5, 5-6 and 11 respectively of the SLC11A1 gene as described by Zhang et al. (2009).

Table 1: Primer pairs for amplification of exon 11of bovine SLC11A1 gene

Position Primer Name Sequence PCR amplicon size Tm Restriction enzyme PCR-RFLP Pattern
Exon 4-5 P1 5’–GCGACTGGCTGCCCGGCT-3’ 1200 bp 67oC Bgl II 645 bp and 555 bp
5’–CTGTGCCAATGACTTCCTGC–3’ CFR13I (Sau96I) 580 bp, 540 bp and 80 bp
Exon 5-6 P2 5’ –GCCCCGCATTCTCCTCTGG–3’ 600 bp 60oC TaqI, 561 bp, 27 bp and 12 bp
5’-CCGTAGTTATCGAGGAAGAG–3’ RsaI 493 bp and 107 bp
Ava II 344 and 256 bp
Exon 11 P3 5’–AAGGCAGCAAGACAGACAGG–3’ 231 bp 69oC Pst I 231bp, 200 bp and 31bp
5’– CAGCCAGGAGACCCACG–3’ Hae III 140 bp, 72bp and 19bp

Polymerase chain reaction (PCR) was carried out in a final volume of 25 µl reaction mixture containing 12.5 µl of amplicon redeye master mix, 10 pM of each forward and reverse primer and 50 ng of Genomic template DNA. The thermal cycling profile for the reaction include initial denaturation at 95oC for 3 min followed by 35 cycles of denaturation at 95o C for 30 sec, annealing at 60 o C – 69o C for 30 sec, extension at 72o C for 1 min and final extension at 72o C for 10min (Table 1). The amplified products were then resolved through 1.5 percent agarose gel electrophoresis and visualized in UV transilluminator (Bio Rad, USA) after staining with ethidium bromide. PCR amplicons were subjected to overnight digestion at 350C using appropriate restriction endonucleases and then inactivated at 600C  to 800C for 20 min. PCR-RFLP pattern of exonic regions 4-5 (1200 bp) was studied using CFR13I and BglII restriction enzyme digestion, exonic regions 5-6 (600 bp) using Taq I, RsaI and AvaII restriction enzyme digestion and exon 11 using Pst I and Hae III (Table 1). Inactivated PCR-RFLP products were subjected to 2 per cent gel electrophoresis and visualized in UV transilluminator (Bio Rad, USA).

Result and Discussion

Johne’s disease was confirmed as negative in all the suspected animals based on PCR technique. Based on PCR-RFLP pattern at SLC11A1 exon 4-5 (Bgl II and CFR13I) , 5-6 (Taq1 and Rsai) and 11 (Hae III)  regions did not reveal any polymorphism and all the samples showed only monomorphic pattern (Fig. 1,  2 and 3).

1200bp
  500bp
  600bp

a)    PCR amplification product

645 bp

555 bp

b) Cfr13I (Sau961) Restriction digestion

580bp

540bp

c) BglII Restriction digestion

Fig. 1: PCR amplification and PCR-RFLP pattern of SLC11A1 gene :Exon 4-5

600 bp

a)    PCR amplification product

493 bp

 

107 bp

b)     RSa I Restriction digestion

561 bp

c)   Taq I Restriction digestion

d)

344 bp

256 bp

Ava II Restriction digestion

Fig. 2: PCR amplification and PCR-RFLP pattern of SLC11A1 gene :Exon 5-6 (600 bp)

However, PCR-RFLP analysis (Pst I) of Exon 11 revealed three genotypes CC (231 bp), CG (231 bp, 200 bp, 31 bp) and GG (200 bp, 31 bp) (Fig. 3b). This indicates the presence of SNP (confirming C > G transversion) in exon 11 coding region. Similar result was also identified at (g.1066 C > G) in exon 11 of Holstein by PCR-SSCP and sequencing (Zhang et al., 2009).

a)    PCR amplification product b)    Pst1 Restriction Enzymes Digestion c)   HaeIII Restriction Enzymes Digestion

Fig. 3: PCR Amplification and PCR-RFLP pattern of SLC11A1 gene: Exon 11 (231bp)

The genotypic frequencies in pooled samples were estimated as 0.24 (CC), 0.48 (CG) and 0.28 (GG) (Table 2). The frequency of C and G alleles were established as 0.58 and 0.42 respectively in normal healthy animals and it was as 0.47 and 0.53 respectively in suspected animals.

Table 2: Gene and genotype frequency of the alleles at exon 11 of SLC11A1 gene in Jersey crossbred cattle

Samples (n) Genotype Genotype Frequency Gene Frequency χ2 value
C G (P>0.01)
Pooled (52) CC 0.24 0.48 0.52 0.39
CG 0.48
GG 0.28
Normal (12) CC 0.33 0.58 0.42 4.06
CG 0.5
GG 0.17
Suspected (40) CC 0.23 0.47 0.53
CG 0.5
GG 0.27

Chi-square test was carried out to test the null hypothesis for Hardy-Weinberg equilibrium. Results revealed no difference between observed and expected number (P =0.01). Fisher test shows no significant (df = 2, P > 0.01, χ2 = 4.06) association between genotypic frequencies of healthy and suspected animals. However, the results reveal that C alleles were common in healthy animals with the frequency of 0.58 and G allele frequencies were common in suspected animals with frequency of 0.53. The presence of polymorphism in exon 11 is due to single nucleotide changes at g.1066 (C > G).  The C > G transversion in coding region resulted in the amino acid change, which might affect the function of SLC11A1 gene. SLC11A1 may also have pleiotropic effect on the expression of MHC and surface antigen expression in mice (Lang et al., 1997).

Conclusion

In conclusion, polymorphism was not identified in exonic 4-5 and 5-6 regions. Though polymorphism in exon 11 of SLC11A1 gene in cattle was observed, it failed to exhibit any association of the observed allelic variants with the resistance / susceptibility to Johne’s disease as stated by Sadana et al. (2015). Further, studies need to be directed to explore polymorphisms throughout the entire SLC11A1 gene in large number of samples to ascertain their suitability as potential genetic marker for Johne’s disease resistance.

References

  1. Awomoyi, A.A. (2007). The human solute carrier family 11-member 1 protein (SLC11A1): linking infections, autoimmunity and cancer? FEMS. Med. Microbiol., (49), 324-329
  2. Juste, R.A., Garrido, J.M., Geijo, M., Elguezbal, N., Arduriz, G., Atxaerandio, R. and Sevilla, I. (2005). Comparision of blood polymerase chain reaction and enzyme-linked immune sorbent assay for detection of Mycobacterium avium subsp paratuberculosis infection in cattle and sheep. Vet. Diagn. Invest. (17), 354 – 359.
  3. Lang, T., Prina, E., Sibthorpe, D., and Blackwell, J.M. (1997). Nramp1 transfection transfers Ity/Lsh/Bcg-related pleiotropic effects on macrophage activation: influence on antigen processing and presentation. Immun. (65),380-386.
  4. Paixa`o, T. A, Poester, F. P., Carvalho Neta, A.V., Borges, A. M., Lage, A. P., & Santos, R. L. (2007). NRAMP1 3’ Untranslated region Polymorphisms Are Not Associated with natural resistance to Btucella abortus in Infect. Immun., 75(5), 2493. DOI: 10.1128/IAI.01855-06.
  5. Reddacliff, L.A., Beh, K., McGregor, H., & Whittington, R.J. (2005). A preliminary study of possible genetic influences on the susceptibility of sheep to Johne’s disease. Vet., 83, 435–441.
  6. Sadana,T., Vir Singh, R., Vir Singh, S., Saxena, V.K., Sharma, D., Singh, P. K., Kumar, N., Gupta, S., Chaubey, K.K., Jayaraman, S., Tiwari, R., Dhama, K., Bhatia, A. K., & Sohal, J. S. (2015). Single nucleotide polymorphism of SLC11A1, CARD15, IFNG and TLR2 genes and their association with Mycobacterium avium Subspecies paratuberculosis infection in native Indian cattle population. Indian Journal of Biotechnology, 14, 469 – 475.
  7. Sambrook, J., Fritsch, E. F., & Maniatis, T. (1989). Molecular cloning: A laboratory manual. Cold Spring Harbour Library Press., Volume 3, 6.3 – 6.4.
  8. Sechi, L.A., Gazouli, M., Sieswerda, L.E., Molicotti, P., Ahmed, N., Ikonomopoulos, J., Scanu, A.M., Paccagnini, D., & Zanetti, S. (2006). Relationship between Crohn’s disease, infection with Mycobacterium avium subspecies paratuberculosis and SLC11A1 gene polymorphisms in Sardinian patients. J. Gastroenterol. (12), 7161 – 7164.
  9. Zhang, C., Wang, Y., Chen, H., Gu, C., & Fang, X. (2009). SLC11A1 gene Polymorphism are not associated to somatic cell score and Milk yield in Chinese Holstein.Veterinary Immunology and Immunopathology. (127), 389-392.
Abstract Read : 35 Downloads : 8
Previous Next

Submit Case Reports for Special Issue (Dec’19)

Recommend IJLR to include in UGC-CARE list

Download Completed format here

IJLR_UGC CARE Recommendation

And

Recommendations of new journals should be routed by universities and colleges as follows:

  1. Universities: IQAC cell to respective regional CARE University
  2. Affiliated colleges: College IQAC cell to parent university’s IQAC cell. Parent university IQAC cell will forward to respective regional CARE University.

You can find Zonal UGC-CARE address here https://ugccare.unipune.ac.in/site/website/ugc-contact.aspx

Close