Infection with Riemerella anatipestifer in ducklings produces a contagious disease, known as new duck disease or riemerellosis which was reported in Kerala from 2008 onwards (Priya et al., 2008; Soman et al., 2014; Somu et al., 2016 and Surya et al., 2016). During earlier periods, R. anatipestifer was mis-identified as Pasteurella multocida due to their morphological and cultural similarities. Identification of these agents based on conventional methods such as cultural and biochemical tests were time consuming and further confusing. Hence, molecular techniques are much more needed for earlier diagnosis. Genomic characterisation techniques like PCR which replaced these traditional cultural methods for rapid identification of pathogenic bacteria (Tenovar et al., 1995). It is also possible that clinically healthy ducks carries R. anatipestifer in their respiratory tract. Yamamoto and Harayama (1995) found that gyrase B-encoding gene (gyrB), a type II DNA topoisomerase, is universally present in all bacterial strains and hence could form a suitable gene for bacterial identification. Hence, a study was framed with the objectives of standardisation of gyrB gene based PCR and its utility for preliminary identification of isolates and epidemiological surveys.

Materials and Methods

Revival and Identification of Bacteria

1. anatipestifer isolate (RA1) maintained in the Department of Veterinary Microbiology, College of Veterinary and Animal Sciences, Mannuthy, as lyophilized form was revived by experimental inoculation of 0.5 ml each of suspension with 3×10⁸ cfu/ml concentration into two ducklings of one-week of age. Liver, heart blood and throat swabs collected from dead birds were utilized for both isolation and molecular studies. The identity of the revived bacteria was confirmed by conventional methods (Surya et al., 2016) and R. anatipestifer species-specific PCR assay (Kardos and Kiss et al., 2006).

Extraction of DNA

The DNA was extracted from revived R. anatipestifer culture and also from pooled tissue samples of liver and heart blood from inoculated ducklings (Sambrook and Russell, 2001). The DNA from throat swabs was extracted using Multi sample DNA Purification Kit of Himedia (Mumbai, India) as per the manufacture’s instruction. The concentration and purity were measured using Nanodrop (Thermo Scientific).

Standardisation of gyrB Gene PCR

The DNA from RA1 was used for the standardization of gyrB gene based PCR. The primers were designed using primer 3 software were forward (F) 5’ GGCTAAGGCAAGACAAGCTG 3’ and reverse (R) 5’ GCAGTTCCTCCTGCAGAGTC 3’. The DNA from RA1 was used to perform gradient PCR using different annealing temperatures (60ºC to 70ºC) with varying concentrations of primers (10, 20 and 30 pmol/µL). An optimum annealing temperature and primer concentration could be arrived by the following reaction mixture and protocols. Composition of single reaction mix for amplification was 10 µL of EmeraldAmp® GT PCR Master Mix, 1 µL each of  forward and reverse primer (10 pM/µL), 2 µL of template DNA and 6 µL of nuclease free water. The cycling protocol followed with initial denaturation at 95ºC for 5 min, followed by 30 cycles of denaturation at 95ºC for 45 sec, annealing  at 65.1ºC for 30 sec, extension at 72ºC for 30 sec with a final extension at 72ºC for 10 min. The PCR amplification was carried out in a thermo cycler (Biorad, USA-Model: MJ Mini). The amplified products were detected by submarine gel electrophoresis in three per cent agarose, visualized under UV transilluminator and the results were documented in a gel documentation system (Bio- Rad laboratories, USA). Specificity and sensitivity of the designed gyrB primers were estimated.

Screening of Throat Swabs for gyrB Gene by PCR

Throat swabs were collected from 60 apparently healthy ducks of University Poultry and Duck Farm, Mannuthy were used for both isolation and screening of gyrB by PCR. Genomic DNA extracted from the liver, heart blood and throat swabs of dead ducklings were also checked.

Results and Discussion

Revival and Identification of R. anatipestifer

The RA1 was revived successfully from both the inoculated ducklings, which developed clinical signs suggestive of riemerellosis like loss of appetite, staggering gait, listlessness, nervous disorder, greenish diarrhoea and death. The BHIA supplemented with sterile defibrinated bovine blood (BA) at five to ten per cent level was used for isolation. The culture plates of heart blood and liver of inoculated ducklings revealed smooth, convex, moist, greyish-white, translucent and butyrous colonies measuring (1-3 mm) after 24 h incubation at 37ºC. No growth could be observed from throat swabs even after 3 days of incubation.  Frommer et al. (1990), Priya et al. (2008), Surya (2011), Sabnam (2015) and Shancy (2015) also used bovine BA as an enriched medium for primary isolation of the organism from clinical samples. Segers et al. (1993) observed smooth, non-pigmented colonies on chocolate agar while Songer and Post (2005) observed the colonies as convex, transparent and butyrous on BA upon micro aerophillic conditions with incubation at 37^oC. The organism was Gram-negative, non-motile and morphology varied from cocco-bacilli, short rods to filamentous forms, non-haemolytic on BA, grew micro aerobically and did not grow on Mac Conkey agar. Similar colony characters were also observed by Rimler and Nordholm (1998) and Shome et al. (2004).

Riemerella anatipestifer was differentiated from P. multocida based on their biochemical characteristics such as indole production, gelatin liquefaction and ornithine decarboxylase utilization. P. multocida was positive for indole and ornithine decarboxylase utilization and did not liquefy gelatin (OIE, 2010). The isolate was found to be positive for gelatin liquefaction, catalase and oxidase tests. It was negative for IMViC and ornithine decarboxylase test. The results were in accordance with Vancanneyt et al. (1999), Shome et al. (2004), Surya (2011) and Shancy (2015). Based on the morphological, cultural and biochemical characteristics, the RA1 isolate was identified as R. anatipestifer.

Riemerella anatipestifer Species-Specific PCR

Genomic DNA was extracted from R. anatipestifer culture, pooled tissue samples of liver and heart blood and throat swabs from inoculated ducklings as per Sambrook and Russell (2001) and kit method, respectively. As they had desired purity and concentration, it was utilized for R. anatipestifer species specific PCR and the amplicons were noticed at 546 bp from RA1, liver and heart blood. Similar results were reported by Soman et al. (2014) and Shancy (2015). The throat swab showed negative result.

Standardisation of gyrB Gene PCR

James (2010) and Kuhn et al. (2011) utilized 16S rRNA as molecular marker to detect pathogenic bacteria. As it has low mutation rate, it was often difficult to differentiate closely related bacteria. Later, gyr B gene was identified as an equally good marker sequence by Yamamoto and Harayama (1995), Kumar et al. (2006) and Takeda et al. (2010) for the classification of bacteria at the species and subspecies level. Wang et al. (2012) designed a pair of PCR primers to amplify gyrB gene sequence of R. anatipestifer and compared it with 16S rRNA sequence-based PCR and concluded that gyrB-based PCR was more accurate. Evolutionary rate of gyrB gene created by mutation is faster than any other protein-coding genes. This was considered as main criteria behind its selection and application. Hence, the gyrB gene was targeted for primer designing and by gradient PCR optimum conditions were arrived, which yielded an amplicon with 162 bp size. Wang et al. (2012) obtained 194 bp product size by gyrB gene PCR. Also Wang et al. (2012) employed 1.5 per cent agarose gel to view the product. As the current study yielded amplicon of lesser molecular weight, 3 per cent agarose was found to be best to view the product by gel documentation system. While evaluating the specificity of gyrB primers, it was noticed that positive amplicons were obtained only from the DNA of the R. anatipestifer culture (Fig. 1).

Fig. 1: Specificity of gyrB primers (Lane1–100 bp ladder, Lane 2- RA1, Lane 3- E. coli, Lane 4- Salmonella, Lane 5- P. multocida, Lane 6- DNA from Duck plague)

The DNA from E. coli, Salmonella, P. multocida and duck plague virus did not yield any amplicons. This clearly showed the specificity of the designed gyrB primers. The selection of primers plays a major role in determining the specificity of the primers as mentioned by Kardos et al. (2006). The sensitivity was found to be at 10⁸dilution (Fig. 2). The gyrB gene based PCR was successfully standardised using the DNA from the RA1 isolate and later utilized for screening the biomaterials. The DNA from liver and heart blood yield positive amplicons for gyrB gene PCR at 162 bp whereas the throat swab from inoculated ducklings showed negative result.

Fig. 2: Sensitivity of gyrB primers

Isolation of R. anatipestifer from Throat Swabs

Out of 60 throat swabs streaked directly on to blood agar, only 4 samples (6.7 per cent) yielded R. anatipestifer. It was confirmed based on the assessment of morphology, cultural characteristics, biochemical reactions and RA specific PCR.

Screening of Throat Swabs by gyrB PCR

In the present study, 56 throat swabs out of 60 samples revealed positive reaction (93.3 %) by gyrB gene based PCR though the bacteria were isolated only from 4 cases (Fig. 3). Wang et al. (2012) also extracted DNA from throat swab of 85 healthy ducks and found 67 samples (78.8 per cent) as positive by gyrB gene based PCR. They also noted 46 percent (26/56) positivity on testing 56 duck livers. The throat swabs of experimentally infected ducklings were found to be negative by gyrB PCR and by isolation studies. But the liver and heart blood yielded positive amplicons and the bacteria was isolated in pure culture. Hence it has been assumed that the R. anatipestifer is present in the throat region as commensal organism like P. multocida. Under stress, the organism may undergo rapid multiplication, followed by dissemination to internal organs through the blood stream. The development of clinical signs occurs when the organisms enters into septicemic phase and thereby the throat could be free of the organism.

Fig. 3: Screening of throat swabs by gyr B gene based PCR

The presence of R. anatipestifer in most of the healthy birds revealed its commensal nature, necessary preventive measures should be taken to avoid stress conditions. These findings revealed that gyrB PCR could be employed for epidemiological studies. The results suggested that the gyrB gene based PCR was a specific and rapid tool for the detection of R. anatipestifer isolates.

Conclusion

In the present study, out of sixty throat swabs tested 56 throat swabs revealed positive reaction by gyrB PCR whereas only 4 cases were positive for bacterial isolation. The throat swabs of experimentally infected ducklings were found to be negative by gyrB PCR and by isolation studies, but their liver and heart blood yielded positive amplicons and the bacteria was isolated in pure culture. Hence, it was concluded that the gyrB gene based PCR could be used as a specific and rapid tool for the detection of R. anatipestifer isolates.

References

1. Frommer, A., Bock, R., Inbar, A. & Zemer, S. (1990). Muscovy ducks as a source of Pasteurella anatipestifer infection in turkey flocks. Avian Pathology, 19, 161-163.
2. James, G. (2010). Universal bacterial identification by PCR and DNA sequencing of 16s rRNA gene. PCR for Clinical Microbiology. pp. 209-214.
3. Kardos, G. & Kiss, I. (2006). Molecular epidemiology investigation of outbreaks of fowl cholera in geographically related poultry flocks. Journal of Clinical Microbiology, 43, 2959-2961.
4. Kuhn, C., Disgue, H., Muhl, P., Orszag, M., Stiesch. and Haverich, H.F. (2011). Evaluation of commercial universal rRNA gene PCR plus sequencing tests for identification of bacteria and fungi associated with infectious endocarditis. Journal of Clinical Microbiology, 49, 2919-2923.
5. Kumar, H.S., Parvathi, A., Karunasagar, I. & Karunasagar, I. (2006). A gyrB-based PCR detection of Vibrio vulnificus and its application for direct detection of this pathogen in oyster enrichment broths. International Journal of Food Microbiology, 111, 216-220.
6. OIE (Office International des Epizooties/ The World Organization for Animal Health. (2010). Manual of Diagnostic Tests and Vaccine for Terrestrial Animals, 1, 524-530.
7. Priya, P.M., Pillai, D.S., Balusamy, C., Rameshkumar, P. & Senthamilselvan, P. (2008). Studies on outbreak of new duck disease in Kerela, India. International Journal of Poultry Science. 7, 189-190.
8. Rimler, R.B. & Nordholm, G.E. (1998). DNA fingerprinting of Riemerella anatipestifer isolates from poultry in different countries. Avian Pathology, 42, 101-105.
9. Sabnam, V.S. (2015). Serotyping and molecular characterisation of Riemerella anatipestifer. M.Sc. thesis. College of Veterinary and Animal Sciences, Mannuthy, Thrissur.
10. Sambrook, J. & Russell, D.W. (2001). Molecular Cloning: A Laboratory Manual, 3^rd Cold Spring Harbor Laboratory Press, New York. pp. 1886.
11. Segers, P., Mannheim, W., Vancanneyt, M., DeBrandt, K., Hinz, K.H., Kersters, K. & Vandamme, P. (1993). Riemerella anatipestifer nov., comp. nov., the causative agent of septicemia anserumexudativa, and its phylogenetic affiliation within the Flavobacterium-Cytophaga rRNA homology group. International Journal of Systematic Bacteriology, 43, 768-776.
12. Shancy, C. (2015). Standardisation of outer membrane protein based ELISA to detect antibodies against new duck disease, M.Sc. thesis. College of Veterinary and Animal Sciences, Mannuthy, Thrissur.
13. Shome, R., Shome, B.R., Rahman, H., Murugkar, H.V, Kumar, A., Bhatt, B.P. & Bujarbarauah, K.M. (2004). An outbreak of Riemerella anatipestifer infection in ducks in Meghalaya. Indian Journal of Comparative Microbiology Immunology of Infectious Disease, 25, 126-127.
14. Soman, M., Nair, S.R., Mini, M., Mani, B.K. & Joseph, S. (2014). Isolation and polymerase chain reaction–based identification of Riemerella anatipestifer from ducks in Kerala. India. Veterinary World, 7, 765-769.
15. Somu, C., Radhakrishnan, U. & Pala, S. (2016). Outer membrane protein A gene based diagnosis of Riemerella anatipestifer infections in ducks. Advances in Veterinary and Animal Science, 4(10): 527-535.
16. Songer, J.G. & Post, K.W. (2005). Bacterial and Fungal Agents of Animal Disease. Veterinary Microbiology (1st Ed.) Elsevier Saunders. pp. 448.
17. Surya, P.S. (2011). Isolation and Characterization of Riemerella anatipestifer from ducks from ducks, M. V. Sc. thesis, College of Veterinary and Animal Sciences, Mannuthy, Thrissur.
18. Surya, P.S., Priya, P.M. & Mini, M. (2016). Protein profiling and restriction enzyme analysis of Riemerella anatipestifer from ducks in Kerala. Indian Journal of Poultry Sciences, 51(2), 151-154.
19. Takeda, K., Kang, Y., Yazawa, K., Gonoi, T. & Mikami, Y. (2010). Phylogenetic studies of Nocardia species based on gyrB gene analyses. Journal of Medical Microbiology, 59(2), 165-171.
20. Tenovar, F.C., Arbeit, R.D., Goering, R.V., Mickelsen, P.A., Murray, B.E., Persing, D.H. & Swaminathan, B. (1995). Interpreting chromosomal DNA restriction patterns produced by pulse-field gel electrophoresis: criteria for bacterial strain typing. Journal of Clinical Microbiology, 33, 2233-2239.
21. Vancanneyt, M., Vandamme, P., Segers, P., Torck, C., Coopman, R., Kersters, K. & Hinz, K.H. (1999). Riemerella columbina nov., a bacterium associated with respiratory disease in pigeons. International Journal of Systematic Bacteriology, 49, 289-295.
22. Wang, X., Zhu, D., Wang, M., Cheng, A., Jia, R., Zhou, Y., Chen, Z., Luo, Q., Liu, F., Wang, Y. & Chen, X. (2012). Complete genome sequence of Riemerella anatipestifer reference strain. Journal of Bacteriology, 194, 3270.
23. Yamamoto, S. & Harayama, S. (1995). PCR amplification and direct sequencing of gyrB with universal primer and their application to the detection and taxonomic analysis of Pseudomonas putida Applied Environmental Microbiology, 61, 1104-1109.