NAAS Score 2018

                   5.36

Declaration Format

Please download DeclarationForm and submit along with manuscript.

UserOnline

Free counters!

Previous Next

Detection of Vibrio parahaemolyticus from Marine Crabs Sold in and around Puducherry and Its Public Health Significance

C. Vijayan V. J. Ajaykumar A. Bhattacharya V. Bhanurekka
Vol 8(2), 189-204
DOI- http://dx.doi.org/10.5455/ijlr.20171009021531

Food borne illnesses have major social and economic impacts. The WHO estimates that worldwide food borne and waterborne diarrheal diseases together kill about 2.2 million people annually and in India around 6 per cent of the population. Vibrio parahaemolyticus has recently been recognized as one of the most important food borne pathogens as the leading causal agent of human acute gastro enteritis. This study was conducted to detect the presence of V. parahaemolyuticus from marine crabs sold in puducherry and human stool samples as per the standard procedure. A total of 35 marine crab samples and 50 human stool samples were screened for presence of V. parahaemolyticus. Out of 35 samples, 14 samples (40 per cent) and out of 50 stool specimens, only 2 (4 per cent) were positive for V. parahaemolyticus by conventional methods. This isolates were further subjected to PCR and subjected to biofilm production assay by CRA plate method. Of the 14 isolates, 9 were positive for biofilm production and none of the isolates from human stool samples were positive for biofilm production. The antibiotic resistance profiling of the V. parahaemolyticus isolates does not show high resistance. This can be a major concern as microorganisms can be associated with chronic and recurrent human infections. This study clearly indicates the need for proper handling and processing of seafood especially marine crabs. It is also important that at household level proper hygienic measures should be taken to avoid cross contamination.


Keywords : Vibrio parahaemolyticus Marine Crabs Biofilm Food Borne

Introduction

Marine and Inland fisheries including capture, culture and processing is an important sector in India. It provides employment to millions of people and contributes to food security of the country, with a coastal line of over 8000 kms, an exclusive economic zone (EEZ) of over 2 million sq kms, and with extensive fresh water resources, fisheries play a vital role in rural economy (FAO, 2012). India ranks second in world fish production, contributing about 5.4 per cent of global fish production. Andhra Pradesh, Gujarat, Karnataka, Kerala, Maharashtra, Orissa, West Bengal, Tamil Nadu and Puducherry are key states that have huge potential to enhance India’s seafood export. The total fish production during 2013-14 is at 9.58 million metric tonnes with a contribution of 6.14 million metric tonnes from inland sector and 3.44 million metric tonnes from marine sector respectively. The overall growth in fish production in 2013-14 has been 5.9 per cent, which has been mainly due to 7.3 per cent growth in inland fish production. The growth in marine fish production has been 3.7 per cent (Handbook on Fisheries Statistics, 2014).

The World Health Organization defines Food borne illness as diseases, usually either infectious or toxic in nature, caused by agents that enter the body through the ingestion of food. Food borne diseases are a serious global problem. The WHO (2015) estimates that worldwide food borne and waterborne diarrheal diseases together kill about 2.2 million people annually and in India around 6 per cent of the population.

In majority of food borne illness, number of reported cases of diseases under surveillance is a vast underestimate of the true burden, because most episodes of disease never reach the reporting systems, neither seeks medical care nor makes a specific diagnosis. Laboratories may not be well equipped with the appropriate tests to identify the causative pathogens. The major causative agents of these illnesses involve viruses, bacteria, parasites, toxins, metals, and prions. In particular, microorganisms, especially the bacteria, have become an important group of causative agents as most of morbidity and mortality from food borne illnesses are related to them (Nyenje et al., 2012). Colonization of these bacteria in human beings can cause a broad spectrum of food borne illnesses such as bacteremia, meningitis, urinary tract infection, septicemia, wound infection, central nervous system disorders and gastrointestinal tract disturbances (Ghosh et al., 2007). The food pathogens like Vibrio parahaemolyticus is one such organism as the infection may not cause high mortality. This bacterium was first identified as a cause of food-borne illness during the fall of 1950 within the southern suburbs of Osaka, Japan, where an outbreak of acute gastro enteritis following the consumption of semidried juvenile sardines sickened 272 and killed 20 individuals (Fujino et al., 1953). Vibrio parahaemolyticus has recently be recognized as one of the most important food borne pathogens as the leading causal agent of human acute gastro enteritis, primarily following the consumption of raw, under cooked or mishandled seafood and marine products (Su and Liu, 2007; Pal and Das, 2010 and Roman et al., 2012).

Materials and Methods

A total of 85 samples which includes 35 marine crabs sample (Tamil – Kadal nandu – 35 samples each) and human clinical samples (stool samples n=50) were collected from different fish vendors and markets in and around Puducherry. Human stools samples were collected from seafood vendors where the marine crabs were collected. The samples were collected in sterile plastic containers and transported to the laboratory for processing. An undertaking was taken from the individuals whose samples were collected. The details of sample collected including the place, type of sample, number of samples etc are given in Table 1.

Table 1: Details of samples collected

S. No. Places in Puducherry Crabs Human Stool Samples
1 Ariyankuppam 5
2 Gubaran market 5
3 Kathirkamam 5
4 Mettupalayam 5
5 Pondy Town Market 5
6 Thavallakuppam 5
7 Govt. & Pvt. Hospital and Lab. 50
  Total 35 50

Processing of Samples

The collected samples were processed in the Biosafety level–II laboratory facility available in the Department of Veterinary Public Health and Epidemiology, Rajiv Gandhi institute of Veterinary Education and Research, Kurumbapet, Puducherry. The crabs were washed with normal saline and then shell, claws and legs of crab were removed and then put into stomacher bag. In case of human stool samples, about 5 gram of the sample was directly added to the enrichment media. The samples remaining after the tests and negative samples were discarded as per standard methods including proper decontamination.

Isolation of Vibrio parahaemolyticus

Vibrio parahaemolyticus was isolated and identified as described in the Bacteriological Analytical Manual of the Food and Drug Administration (Elliot et al., 1995).

Selective Enrichment

The 50 grams of processed meat of sea food samples were placed in 450 ml of alkaline peptone water (APW) to obtain a 10-1 dilution. In case of human stool samples, 5 gram of the sample was enriched in 25 ml of APW and then it was incubated for 24 hours at 370C.

Selective Plating

A loop full of enrichment broth was streaked on to thiosulfate citrate bile salts sucrose (TCBS) agar plates and were incubated at 37°C for 24 hours. After the incubation, V. parahaemolyticus was observed as blue-green coloured colonies. This V. parahaemolyticus colonies (round, 1 to 2 mm in diameter, humid, shiny, sucrose fermenting,) was selected for biochemical tests. Human stool samples were also screened as per the method explained above.

Characterization and Identification of Isolates

The suspected colonies of V. parahaemolyticus were subjected to various tests and confirmed based on the biochemical characteristics. The individual colonies of V. parahaemolyticus from TCBS agar were transferred to TSB and incubated at 370C for 24 hours. Primary Identification Tests like Gram’s Staining, Catalase Test (Slide test), Oxidase Test and Motility Test were performed. Secondary Identification Tests like Indole production, Methyl Red (MR) Reaction, VogesProskauer (VP) Reaction, Citrate Utilization Test, Urease Activity, Gelatin Hydrolysis/ Liquefactions and Carbohydrate Utilization Test were preceded as per the standard procedures.

Differentiation between Vibrio parahaemolyticus and Vibrio vulnificus

Vibrio parahaemolyticus and Vibrio vulnificus are phenotypically similar, and difficult to differentiate. The differentiation between the Vibrio parahaemolyticus and Vibrio vulnificus were done as per the characteristic in the Table 2.

Table 2: Differentiation between Vibrio parahaemolyticus and Vibrio vulnificus

S. No. Characteristics Vibrio parahaemolyticus Vibrio vulnificus
1 TCBS agar Bluish green Bluish green
2 Oxidase Positive Positive
3 Growth in 0, 3, 6, 8 and 10 per cent NaCl Growth noticed in 3,6,8 and 10 per cent NaCl Growth noticed only in 3 and 6 per NaCl
4 Acid from Sucrose Negative Negative
5 Acid from Lactose Negative Positive
6 Acid from Arabinose Positive Negative
7 Acid from D-mannitol Positive Variable

Molecular Confirmation of the Isolates

After the isolation and biochemical characterization, Vibrio parahaemolyticus isolates were processed for further confirmation by tox R for Vibrio parahaemolyticus by Polymerase Chain Reaction (PCR).

Extraction of Template DNA

The DNA from Vibrio parahaemolyticus were extracted using Boil cell method. A single pure colony of bacterial culture was inoculated into five milliliter of Nutrient broth and incubated at 370C for 18 hrs. One point five milliliters of this broth culture was transferred to an eppendorf tube and centrifuged at 3000 rpm for 10 minutes. The pellet was washed twice in PBS and then it was resuspended in 100 µl of triple distilled water. This was boiled for 10 minutes and immediately chilled at -200C for 30 minutes. The sample was then thawed and centrifuged at 3000 rpm for 5 minutes. The supernatant which contained template DNA was stored at -200C till use. Five micro litres of the supernatant was used as template DNA for PCR. Bacterial culture lysate similarly prepared from the reference strain was used as template DNA for positive control in PCR.

Polymerase Chain Reaction (PCR) For the Detection of Vibrio parahaemolyticus

The following sets of primers were used for the detection toxR gene of V. parahaemolyticus (Kim et al., 1999) as shown in Table 3 and PCR reaction mixture for Vibrio parahaemolyticus is given in Table 4.

Table 3: Details of primers used

S. No. Organism Specificity Primer Primer Sequence (5’-3’) Size
1 V.parahaemolyticus nt 609-629 and 956-958 of a subunit coding for forward and reverse primer position of toxR  

 

toxR

Forward 5’GTCTTCTGACGCAATCGTTG3′

Reverse 3’ATACGAGTGGTTGCTGTCATG5′

 

 

 

368bp

Table 4: PCR reaction mixture for Vibrio parahaemolyticus

S. No. Reaction Mixtures Volume (µl)
1 Template DNA 2
2 Primers Forward 1
Reverse 1
3 Master mix 10
4 Triple distilled water 6
  Total 20 µl

The 20 µl reaction mixtures were prepared in 0.2 ml thin PCR tubes. The PCR amplification were carried out in an automated thermal cycler (Eppendroff mastercycler, Germany) using protocol in Table 5.

Table 5: The PCR protocol

S. No. Steps toxR Gene
1 Primary Denaturation 94°C for 5 minutes
2 Denaturation 94°C for 1 minutes
3 Annealing 63°C for 1 minutes
4 Extension 72°C for 2 minutes
5 Final Extension 72°C for 7 minutes
6 No. of Cycles 20

Submarine Agarose Gel Electrophorsis

The PCR products were analyzed by submarine agarose gel electrophoresis. Agarose (1.5 per cent) was dissolved in TAE buffer (1X) by heating. When the mixture was cooled around 500C, ethidium bromide was added to a final concentration of 0.5 µg/ml. Agarose was then poured into clean, dry, gel platform setup provided by Tarsons and the comb was kept in proper position. Once gel was set, comb was removed gently and the tray containing the gel was placed in the buffer tank.  Buffer (TAE 1X) was poured till the gel was completely submerged. PCR product (10µl) was mixed with loading buffer (1µl of loading buffer per 5µl of the PCR product) and the samples were loaded in the wells. Then 100 bp DNA markers and positive and negative controls were loaded in separate wells. Electrophoresis was carried out at 5V/cm for one hour. The gel was visualized under UV transilluminator and the images were documented in a gel documentation system (Gel Doc It. Images System, UVP).

Bioflim Production Assay For Vibrio parahaemolyticus

Bioflim production in terms of slime production by isolates was determined by cultivation on Congo Red Agar (CRA) plates (Freeman et al., 1989 and Dadawala et al., 2010). A loop full of isolate was streaked onto CRA plates. The plates were incubated at 37°C for 24 hours followed by storage at room temperature for 48 hours. The production of rough black colonies by bacterial cultures indicated the ability for bioflim production.

Antibiogram

Antibiotic susceptibility tests were performed for V. parahaemolyticus according to the National Committee for Clinical Laboratory Standards (NCCLS, 2003). Premeasured antimicrobial discs were applied to the surface of Mueller-Hinton agar plates, previously seeded with each strain and commonly used antibiotics were used in this study.

Preparation of MAC Farland Standard

The turbidity standard solution was prepared by adding 0.5 ml of 0.048 M BaCl2 to 99.5 ml of 0.36 N H2SO4 (one per cent w/v). This solution is equal to half the density of No.1 Mac Farland standard solution. This solution was taken into glass tube, sealed tightly and kept in the dark, at room temperature for further use. The tube was vigorously agitated just before each use.

Preparation and Standardization of Inoculum

Three to four isolated colonies were selected from a pure culture and transferred into sterile nutrient broth and incubated at 370C, overnight. The turbidity of culture was adjusted using solution having half the density of Mac Farland standard No.1. When the broth culture was found to be more turbid, it was diluted with nutrient broth and when the turbidity was found to be less, culture was incubated for more time to achieve the required turbidity.

Inoculation

The swab was dipped into standardized inoculum and excess inoculum was removed from the swab by rotating it several times with a firm pressure on the inside wall of the test tube, above the fluid level. The sterile Mueller Hinton agar (Hi-Media) plates were inoculated by swabbing over its entire surface, within 15 min. after adjusting the density of inoculum. The swabbing procedure was repeated two more times, rotating the plates approximately 600 at each time, so as to ensure an even distribution of inoculums. The inoculums were allowed to dry for 15 min.

Application of Antibiotic Discs

The inoculated plate was left for not more than 15 min. at room temperature to absorb any excess surface moisture before applying the drug impregnated discs. The discs were applied to the surface of the inoculated agar with a sterile forceps. With the tip of the forceps, each disc was gently pressed down to ensure complete contact with the agar surface. During the application of discs care was taken not to place it closer than 15mm from the edge of the plate and the distance between the centre’s of two such discs was not less than 24mm. The inoculated plate was inverted and incubated at 370C for 18 hours after the application of the discs. In this study, 15 locally available antibiotic discs were tested against both E. coli and Vibrio parahaemolyticus isolates.  The isolates were tested against Ampicillin (10 mcg), Amoxyclav (30 mcg), Amikacin (30 mcg), Azithromycin (30 mcg), Chloramphenicol (30 mcg), Cotrimazole (10 mcg), Ciprofloxacin(30 mcg), Cefotaxime (30 mcg), Gentamicin (30 mcg), Metronidazole (50 mcg), Nalidixic acid (30 mcg), Penicillin-G (10 units) Sulphamethiozole (300 mcg), Trimethoprim (25 mcg), Tetracyclin (30 mcg), Polymixcin B (300 units) antibiotic discs.

Results and Discussion

Isolation of Vibrio parahaemolyticus

All the samples collected were subjected to isolation of Vibrio parahaemolyticus by conventional culture technique. Species level differentiation was carried out using carbohydrate utilisation test.

Marine Crab Samples

Out of 35 marine crabs screened, 20 samples had colonies with characteristics of V. parahaemolyticus in TCBS agar. Out of 35, 20 (57.14 per cent) of marine crab samples were positive for V. parahaemolyticus. An overall presence of 57.14 per cent was observed among the seafood. When compared to this a study by Sanjivikumar et al. (2009) revealed lower prevalence of V. parahaemolyticus. They obtained 3 (6.0 per cent) V. parahaemolyticus isolates from 50 sea fish samples when they screened Sardine fish from Puducherry. The incidence of V. parahaemolyticus in seafood had been reported from crabs as 9.3 per cent (Rahimi et al., 2010), and 11 per cent from retail shrimp (Zarei et al., 2012).

Higher prevalence of V. parahemolyticus was observed in a study done by Fishbein et al. (1970). They reported 25 (41.67 per cent) V. parahaemolyticus isolates from 60 Chesapeake Bay crabs. Vibrio parahaemolyticus were isolated from 51 (94 per cent) of 54 shellfish samples, 25 (83 per cent) of 30 shrimp samples, and 22 (73 per cent) of 30 fish samples by Vuddhakul et al. (2000). Kudo et al. (2003) found that 173 (52.58 per cent) sea fish samples were positive for V. parahaemolyticus. These studies were showing comparatively higher prevalence than the present study. Similarly, Odeyemi, (2016) also observed higher prevalence of V. parahaemolyticus when they obtained 2671isolates (47.5 per cent) from 5811 of seafood samples.

Human Stool Samples

Out of 50 human stools sample 2 samples showed typical colonies with characteristics of V. parahemolyticus in TCBS agar. The details of suspected Vibrio parahaemolyticus isolates from the marine crabs and human clinical samples are shown in the Table 6. The growth of suspected V. parahaemolyticus isolates in different solid medias are shown in the Plate 1. However all these isolates were subjected to various biochemical tests for further confirmation.

Table 6: Details of Vibrio parahemolyticus from marine crabs and human stool samples

 

 

 

Samples

Gubar market Kathirkamam Kurumbapet Mettupalayam Nellithoppu Pondy town market Thavalakuppam Villianur No. of Positive samples Per cent
Marine crab 3 3 0 3 3 3 2 3 20/35 57.14
Human stool 2 02/50 04.00
Total 22/85 25.88

Food borne disease caused by V. parahaemolyticus is rarely reported from Asian countries. This is due to the self limiting nature of infection and lack of confirmatory diagnosis. However, the increase in consumption of raw or undercooked seafood and the phenomenon of global warming and increased water temperature has led to increased concern about V. parahaemolyticus and the enhanced risk of V. parahaemolyticus infection. In this study 2 (4.0 per cent) isolates were obtained from human diarrhoea cases. In Galicia, Northern Spain, in 1999, an outbreak of 64 cases of V. parahaemolyticus gastroenteritis was recorded by Lozanoleón et al. (2003). In 2004, another outbreak of 80 cases in Spain has been reported by Urtaza et al. (2005). Depaola et al. (2000) reported two outbreaks in Texas (416 cases) and in Washington (43 cases). Bhoopong et al. (2007) found that 6.5 per cent to 10.9 per cent of clinical specimens were positive for V. parahaemolyticus. The prevalence of V. parahaemolyticus was 4.2 per cent in 2009 at Kolkata when they screened human stool samples from diarrhea cases (Pazhani et al., 2014).

TCBS agar Blood agar Muller Hinton agar

Plate 1: Growth of V. parahaemolyticus isolates in different solid media

Biochemical Tests for V. parahaemolyticus

When subjected to biochemical tests, it was found that all these isolates were positive for catalase test, oxidase test, motility, indole production and urease test. These isolates were negative for MR, VP and citrate utilisation. The results of these tests clearly indicated that they belonged to Vibrio species. These isolates were then subjected to carbohydrate utilisation tests for identification of species. The results suggested that out of 22 isolates only 16 isolates (14 from marine crabs and 2 from human stools) were showing reaction similar to that of Vibrio parahaemolyticus. Remaining 6 isolates were showing characteristics of Vibrio vulnificus. The details about the various biochemical tests of suspected Vibrio parahaemolyticus isolates are given in the Table 7.

 

 

 

 

Table 7: Biochemical characteristics of Vibrio parahaemolyticus isolates from marine crabs and human stool samples

Sam. Marine crabs Human stool
Test 1 2 3 7 8 10 11 15 20 23 24 27 30 32 12 48
Shape R/C R/C R/C R/C R/C R/C R/C R/C R/C R/C R/C R/C R/C R/C R/C R/C
Cat. + + + + + + + + + + + + + + + +
Oxi + + + + + + + + + + + + + + + +
Mo + + + + + + + + + + + + + + + +
I + + + + + + + + + + + + + + + +
MR
VP
Ci
TSI
U + + + + + + + + + + + + + + + +
N + + + + + + + + + + + + + + + +
Ly. + + + + + + + + + + + + + + + +
D-glu. + + + + + + + + + + + + + ++ + +
Lac.
Sor.
Suc
D-man + + + + + + + + + + + + + + + +
In
Mal + + + + + + + + + + + + + + + +
Cel
Ar + + + + + + + + + + + + + + + +

R : Rod shaped, C: Curved, + : Positive, – : Negative, Cat: catalase test, Oxi: Oxidase test, Mo: Motility test, I: Indole production, MR: Methyl Red, VP: Voges Proskauer, Ci: Citrate utilization test, TSI: Triple Sugar Iron agar reaction, U: Urease test, N: NaCl tolerance test, Ly: Lysine decarboxylase test, D-glu: D-glucose, Lac: Lactose, Suc: Sucrose, Sor: Sorbitol, D-man: D-mannitol, In: Inositol, Mal: Maltose, Cel: Cellobiose, Ar: Arabinose, Sam: Samples; Ch: Chevon

Detection of tox R Gene of Vibrio parahemolyticus by PCR

After the biochemical characterization and identification, all 16 isolates (14 from marine crab and 2 from human stools) were screened by PCR for detection of toxR gene. All the 16 isolates were showing the presence of toxR gene (Fig. 1). The tox R transmembrane protein encoded by the toxR gene is concerned with the regulation of genes in Vibrio species. Kim et al. (1999) developed a specific PCR to target the toxR gene to identify V. parahaemolyticus. Rosec et al. (2009) had reported that the PCR targeting the toxR gene is an efficient and reliable tool for the identification of V. parahaemolyticus. Based on this reports, in the present study after the biochemical characterization and identification, all 16 isolates (14 from marine crab and 2 from human stools) were screened by PCR for detection of toxR gene. All the 16 isolates were showing the presence of toxR gene by the amplification of 368 bp products. Similarly Kim et al., 1999 performed PCR for V. parahaemolyticus toxR gene, on 373 strains of V. parahaemolyticus and all were positive for toxR gene. Pal and Das (2010) conducted a study on 90 fish samples and found that 66.7 per cent isolates were positive for V.parahaemolyticus with presence of toxR gene.

Fig.1: PCR profile of Vibrio parahaemolyticus isolates for toxR gene

L1- 100 bp molecular marker, L2- negative control, L3- positive control, L4 to L10- toxR gene at 368 bp from positive samples.

Biofilm Production Assay

In biofilm production assay of Vibrio parahaemolyticus by using the modified Congo Red Agar (mCRA), out of 14 isolates of V. parahaemolyticus from marine crab samples 9 (64.29 per cent) and none of the isolates from human stool samples were having the ability of biofilm production. The results, developed in this study, showed that Vibrio, food-borne pathogen, is able to produce biofilm on abiotic surface.

Almost same type of results was noticed in a study by Elexson et al. (2014) in Malaysia isolated a total 36 strains of V. parahaemolyticus strains from seafoods and screened for the in vitro biofilm formation in the wells of commercially available microtiter plates. The biofilm production was measured at room temperature and at the end it had 61.1 per cent of weak biofilm producers, 13.89 per cent of moderate biofilm producers and 25 per cent of strong biofilm producers. Chari et al. (2014) reported 14.0 per cent of Vibrio isolates had biofilm producing ability in congo red agar and was lower than the present study.

Antibiogram of the Vibrio parahemolyticus Isolates from Marine Crabs and Human Stool Samples

All the 16 isolates of the Vibrio prahaemolyticus from the marine crabs and human stools samples were subjected to the Antibiotic Sensitivity (ABST) by disc diffusion method with 16 antibiotics. The detailed antibiogram of the isolates from marine crabs and human stool samples are summarized in the Table 8 and percentage wise antibiogram of V. parahemolyticus isolates from marine crabs and human stools samples were shown in Fig. 2 and 3 respectively.

Table 8: Antibiogram of Vibrio parahaemolyticus isolates from marine crabs and human stool samples

S. No. Samples Marine Crabs Human stool
1 Isolates no 1 2 3 7 8 10 11 15 20 23 24 27 30 32 12 48
2 Amipicillin S R I S R R I R S I R I R S R R
3 Amoxyclav S I I I I I I I S I I I I S I I
4 Amikacin R S R R R R I S R R R R R I I R
5 Azithromycin I R I S R R R R R S I R R R I R
6 Chloramphenicol S I I S I R I R I I S I S I S I
7 Cotrimazole R R R R S S I S S S I I R R R R
8 Ciprofloxacin S R I S S S I I I S R I I R I S
9 Cefotaxime I S R R S I S I S I S S R I I I
10 Cefazolin S I I I S S R R R S I I S S S R
11 Gentamicin S I R S R S I S S S R R S S S I
12 Metronidazole S R R S R S S R I S R I R R S R
13 Moxifloxacin S I S R S I S R I R I S S S I S
14 Nalidixic acid I R I R I S I R R I I I I S R R
15 Sulphamethazole S R R S R I S R I R S R I R R S
16 Trimethoprim R S R S I S S R R I R S S S I S
17 Tetracyclin S I R S I R S R S R S R I I R R

S: Sensitivity, R: Resistance, I: Intermediate

Fig. 2: Percentage wise antibiogram of V. parahaemolyticus isolates from marine crabs samples

All the 30 isolates of V. parahaemolyticus showed sensitivity to most of the antibiotics used in this test. The 14 isolates of V. parahaemolyticus from the marine crabs showed sensitivity to cefotaxime, cefazolin (42.86 per cent), moxifloxacin, trimethoprim (50 per cent) and gentamicin (57.14 per cent). Large number of isolates showed resistance against amikacin (71.43 per cent), followed by azithromycin (64.29 per cent), sulphamethazole (50 per cent) and amipicillin, cotrimazole and metronidazole (42.86 per cent). Intermediate action was shown by the isolates towards amoxyclav (78.56 per cent), cholramphenicol (57.14 per cent), ciprofloxacin (42.86 per cent) and nalidixic acid (64.29 per cent). A total of 2 isolates of V. parahaemolyticus were isolated from the human clinical stool samples, in that all the isolates did not show a complete sensitivity to those antibiotics used in this study but these isolates showed combined pattern of results. One isolate was sensitive to antibiotics like cholramphenicol, ciprofloxacin, gentamicin, moxifloxacin and trimethoprim while other isolate showed intermediate action against these antibiotics. All the V. parahaemolyticus isolates from the human clinical stool samples were resistant to antibiotics, amipicillin, cotrimazole, nalidixic acid and tetracycline.

Fig. 3: Percentage wise antibiogram of V. parahemolyticus isolates from human stools samples

In the present study a total of 16 isolates of V. parahaemolyticus were subjected to antibiotic sensitivity test. In that 74.07 per cent of isolates showed resistance to amikacin followed by 59.26 per cent of isolates showing resistance to azithromicin, 55.56 per cent of isolates showed resistant to metronidazole and 51.85 per cent of isolates were resistant to amipicillin, sulphamethazole and tetracycline. Eleven per cent of the isolates were resistant to ciprofloxacin, 7.41 per cent of isolates were resistant to chloramphenicol and 3.7 per cent of isolates showed resistance to amoxyclav. In a study conducted in Nigeria Adeleye et al. (2008) observed that the V. parahaemolyticus isolates from seafood in Lagos, Nigeria were resistant to amipicillin, chloramphenicol, cotrimozazole, ceftriazone, ciprofloxacin and tetracycline. In a study by Rojas et al. (2011) 19 isolates obtained from oysters and mussels, were found susceptible to nalidixic acid and cefazoline. Pazhani et al. (2014) reported that, 98 per cent (174/178) of the strains of V. parahaemolyticus from diarrheal patients in Kolkata, India were resistant to ampicillin, followed by 3.4 per cent to nalidixic acid, and 1.7 per cent to chloramphenicol. Shaw et al. (2014) screened V. parahaemolyticus isolates from recreational and commercial areas, and found that the isolates showed intermediate resistance to chloramphenicol (96 per cent), followed by ampicillin (25 per cent) and cefataxim (17 per cent). A high per cent of resistance was observed against ampicillin (53 per cent), while a low per cent of resistance was seen against gentamicin (4 per cent). Letchumanan et al., 2015 reported antibiotic resistance for V.parahaemolyticus isolates with 88 per cent isolates resistant to ampicillin, followed by 81 per cent to amikacin and 73 per cent to cefotaxime. Susceptibility testing for V. parahaemolyticus was performed by Krohn et al. (2016) revealed the organism to be susceptible to all of the antibiotics tested. Those antibiotics were Amikacin, Ciprofloxacin, Gentamicin, and Trimethoprim-sulfamethoxazole. The results of antibiotic resistance profiling of the V. parahaemolyticus isolates does not show high resistance.

Conclusion

Results of this present study show that higher prevalence of V. parahaemolyticus was noticed in the marine crabs samples is in the expected lines as marine environment habours the organism. The marine crabs had higher level of V. parahaemolyticus. This may be due to the peculiarity of marine crabs as they are bottom feeders and filter feeders. This can lead to high intake of organisms which are commonly found in the bottom. The results also show proper care should be taken while cooking of seafood, especially when it is fed to children and immune compromised people. Also proper care should be taken when exotic seafood preparation with least or no cooking is consumed. It is also important that in kitchen when ever seafood is prepare, care shall be taken to avoid cross contamination.

References

  1. Adeleye A; Vivian E; Rita N; Stella S and Emmanuel O (2008) Antimicrobial susceptibility of potentially pathogenic halophilic Vibrio species isolated from             seafoods in Lagos, Nigeria. African J. Biotech. 7 (20):3791-3794.
  2. Bhoopong P; Palittapongarnpim P; Pomwised R; Kiatkittipong A; Kamruzzaman M; Nakaguchi Y; Nishibuchi M; Ishibashi M and Vuddhakul V (2007) Variability Of     Properties Of Vibrio Parahaemolyticus Strains Isolated From Individual Patients.            Clin. Microbio. 45(5): 1544–1550.
  3. Chari PVB; Viswadeepika K and Kumar BA (2014) In vitro biofilm forming capacity on abiotic contact surfaces by outbreak-associated Vibrio harveyi J. Coastal Life      Med. 2(2): 132-140.
  4. Depaola A; Kaysner CA; Bowers J and Cook DW (2000) Environmental investigations of Vibrio parahaemolyticus in oysters after outbreaks in Washington, Texas, and NewYork(1997and1998). Environ.Microbiol. 66:4649–4654.
  5. Dadawala AI, Chauhan HC, Chandel BS, Ranaware P, Sandip PS, Singh K, Rathod PH, Shan NM and Kher HN (2010) Assessment of Escherichia coli isolates for In vitro            bioflim production. world, 3(8):364-366
  6. Elexson N, Yaya R, Nor AM, Kantilal HK, Ubong A, Yoshitsugu N, Nishibuchi M and Son R (2014) Biofilm assessment of Vibrio parahaemolyticus from seafood using          Random Amplified Polymorphism DNA-PCR., Food Res. J.,21(1): 59-65
  7. Elliot EL; Kaysner CA; Jackson L and Tamplin ML (1995) cholerae, V. parahaemolyticus, V. vulnificus and other Vibrio spp; In USFDA bacteriological     analytical manual, 8th ed. AOAC International, Arlington, 9.01–9.27.
  8. FAO stat (2012) Food and Agricultural Organization http://www.fao.org/docrep/article/agrippa/665_en-01.htm
  9. Fishbein M; Mehlman IJ and Pitcher J (1970) Isolation Of Vibrio Parahaemolyticus From The Processed Meat Of Chesapeake Bay Blue Crabs. Microbio. 20(2): 176-178.
  10. Freeman DJ, Falkiner FR and Kenne CT (1989) New method for detecting Slime production by coagulase negative Staphylococci. Clin.Pathol.42:872-874
  11. Fujino T; Okuno Y; Nakada D; Aoyama A; Fukai K and Mukai T (1953) On the bacteriological examination of Shirasu food poisoning. J.Osaka Univ. 4: 299–     304.
  12. Ghosh M; Wahi S; Kumar M and Ganguli A (2007) Prevalence of enterotoxigenic Staphylococcus aureus and Shigella in some raw street vended Indian foods. Int.             J.Environ. Res. Public Health, 17: 151–156.
  13. Handbook on Fisheries Statistics 2014. August 2014. Dept of Animal Husbandry, Dairying & Fisheries, Ministry Of Agriculture, Govt. of India, New
  14. Kim YB; Okuda J; Matsumoto C; Takahashi N; Hashimoto S and Nishibuchi M (1999) Identification of Vibrio parahaemolyticus Strains at the Species Level by PCR Targeted to the toxR J. Clin. Microbiol. 31(4): 1173–1177.
  15. Krohn TB; Pica N; Sandora TJ and McAdamc A (2016). Safe to go back in the water? Vibrio parahaemolyticus Wound infection associated with Brackish Water. J Clin             54:1414 –1415.
  16. Kudo HY; Sugiyama K; Nishibuchi M; Chowdhury A; Yatsuyanagi J; Ohtomo Y; Saito A; Nagano H; Nishina T; Nakagawa H; Konuma H; Miyahara M and Kumagai SS (2003)Prevalence Of Pandemic Thermostable Direct Hemolysin-Producing Vibrio            Parahaemolyticus O3:K6 In Seafood And The Coastal Environment In Japan.            Environ. Microbiol. 69(7): 3883–3891.
  17. Letchumanan V; Pusparajah P; Tan LTH; Yin WF; Lee LH and Chan KG (2015) Occurrence and Antibiotic Resistance of Vibrio parahaemolyticus from Shellfish in   Selangor, Malaysia. Microbiol. 6(1417): 1-11
  18. Lozanoleon A; Torres J; Osorio CR and Martínez-Urtaza J (2003) Identification of tdh– positive Vibrio parahaemolyticus from an outbreak associated with raw oyster     consumption in Spain. FEMS Microbiol. Lett. 226: 281-284.
  19. National Committee for Clinical Laboratory Standards (2003). Performance standards for antimicrobial disk susceptibility tests for bacteria that grow aerobically. 8th Wayne: NCCLS; (Approved Standard. NCCLS document M2-A8).
  20. Nyenje ME; Odjadjare CE; Tanih NF; Green E and Ndip RN (2012) Food borne pathogens recovered from ready-to-eat foods from roadside cafeterias and retail        outlets in Alice, Eastern Cape Province, South Africa: Public health implications.        J. Environ. Res. Public Health, 9: 2608–2619.
  21. Odeyemi OA (2016) Incidence and prevalence of Vibrio parahaemolyticus in seafood: a systematic review and Meta analysis, SpringerPlus, 5:464-481.
  22. Pal D and Das N (2010) Isolation, identification and molecular characterization of Vibrio parahaemolyticus from fish samples in Kolkata. Rev.Med. Pharmacol.Sci. 14: 545–549.
  23. Pazhani GP; Bhowmik SK; Ghosh S; Guin S; Dutta S; Rajendran K; Saha DR; Nandy RK; Bhattacharya MK; Mukhopadhyay AK and Ramamurthy T (2014) Trends in the            Epidemiology of Pandemic and Nonpandemic Strains of Vibrio parahaemolyticus Isolated from Diarrheal Patients in Kolkata, India. PLoS Negl Trop Dis. 8(5): 2815-
  24. Rahimi E; Ameri M; Doosti A; Gholampour AR (2010) Occurrence of toxigenic Vibrio parahaemolyticus strains in shrimp in Iran. Foodborne pathog. Dis. 7: 1107 – 1111.
  25. Rojas MVR; Matte MH; Dropa M; Da Silva ML and Matte GR (2011) Characterization of Vibrio parahaemolyticus isolates from oysters and mussels in Sao Paulo, Brazil.             Revista Do Instituto De Medicina Tropical De Sao Paulo, 53: 201-205.
  26. Roman VJ; Sicairos LN; Villasenor FH; Rauda VS and Roman CA (2012) Association of pandemic Vibrio parahaemolyticus O3:K6 present in the coastal environment of Northwest Mexico with cases of recurrent diarrhea between 2004 and 2010.     Environ. Microbiol. 78: 1794–1803.
  27. Rosec JP; Simon M; Causse V and Boudjemaa M (2009) Detection of total and pathogenic Vibrio parahaemolyticus in shellfish: Comparison of PCR protocols        using pR72H or toxR targets with a culture method. J. Food Microbiol.   129: 136-145.
  28. Sanjivikumar S; Ajaykumar VJ; Bhattacharya A and Bhanurekha V (2009) Assessment of Microbial Quality of Seafish(Sardinella fimbriata) sold in Puducherry. meat sci. 6(1):61-63.
  29. Shaw KS; Goldstein RER; He X; Jacobs JM; Crump BC and Sapkota AR (2014). Antimicrobial Susceptibility of Vibrio vulnificus and Vibrio parahaemolyticus    Recovered from Recreational and Commercial Areas of Chesapeake Bay and        Maryland Coastal Bays. Plus ONE, 9(2): 1-11.
  30. Su YC and Liu C (2007) Vibrio parahaemolyticus ; a concern of seafood safety. Food 24
  31. Urtaza MJ; Simental L; Velasco D; Depaola A; Ishibashi M and Nakaguchi Y (2005) Pandemic Vibrio parahaemolyticus O3:K6, Europe. Emerging Infect. Dis. 11:1319–
  32. Vuddhakul V; Chodhury A; Laohaprertthisan V; Pungrasamee P; Patararungrong N; Thianmontri P; Ishibashi M; Matsumoto C and Nishibuchi AM (2000) Isolation Of A Pandemic O3:K6 Clone Of A Vibrio Parahaemolyticus Strain From Environmental and Clinical Sources In Thailand. Environ. Microbiol. 66(6):2685–2689.
  33. World Health Organisation (2015) Fact sheet. Food borne Disease Strategy 2010-2015.
  34. Zarei M; Borujeni MP; Jamnejad A; Khezrzadeh M (2012) Seasonal prevalence of Vibrio     species in retail shrimps with an emphasis on Vibrio parahaemolyticus. Food Control,             25:107–109.
Abstract Read : 466 Downloads : 90
Previous Next
Close