C. Vijayan V. J. Ajaykumar A. Bhattacharya V. Bhanurekka Vol 8(2), 189-204 DOI- http://dx.doi.org/10.5455/ijlr.20171009021531
Food borne illnesses have major social and economic impacts. The WHO estimates that worldwide food borne and waterborne diarrheal diseases together kill about 2.2 million people annually and in India around 6 per cent of the population. Vibrio parahaemolyticus has recently been recognized as one of the most important food borne pathogens as the leading causal agent of human acute gastro enteritis. This study was conducted to detect the presence of V. parahaemolyuticus from marine crabs sold in puducherry and human stool samples as per the standard procedure. A total of 35 marine crab samples and 50 human stool samples were screened for presence of V. parahaemolyticus. Out of 35 samples, 14 samples (40 per cent) and out of 50 stool specimens, only 2 (4 per cent) were positive for V. parahaemolyticus by conventional methods. This isolates were further subjected to PCR and subjected to biofilm production assay by CRA plate method. Of the 14 isolates, 9 were positive for biofilm production and none of the isolates from human stool samples were positive for biofilm production. The antibiotic resistance profiling of the V. parahaemolyticus isolates does not show high resistance. This can be a major concern as microorganisms can be associated with chronic and recurrent human infections. This study clearly indicates the need for proper handling and processing of seafood especially marine crabs. It is also important that at household level proper hygienic measures should be taken to avoid cross contamination.
Keywords : Vibrio parahaemolyticus Marine Crabs Biofilm Food Borne
Introduction
Marine and Inland fisheries including capture, culture and processing is an important sector in India. It provides employment to millions of people and contributes to food security of the country, with a coastal line of over 8000 kms, an exclusive economic zone (EEZ) of over 2 million sq kms, and with extensive fresh water resources, fisheries play a vital role in rural economy (FAO, 2012). India ranks second in world fish production, contributing about 5.4 per cent of global fish production. Andhra Pradesh, Gujarat, Karnataka, Kerala, Maharashtra, Orissa, West Bengal, Tamil Nadu and Puducherry are key states that have huge potential to enhance India’s seafood export. The total fish production during 2013-14 is at 9.58 million metric tonnes with a contribution of 6.14 million metric tonnes from inland sector and 3.44 million metric tonnes from marine sector respectively. The overall growth in fish production in 2013-14 has been 5.9 per cent, which has been mainly due to 7.3 per cent growth in inland fish production. The growth in marine fish production has been 3.7 per cent (Handbook on Fisheries Statistics, 2014).
The World Health Organization defines Food borne illness as diseases, usually either infectious or toxic in nature, caused by agents that enter the body through the ingestion of food. Food borne diseases are a serious global problem. The WHO (2015) estimates that worldwide food borne and waterborne diarrheal diseases together kill about 2.2 million people annually and in India around 6 per cent of the population.
In majority of food borne illness, number of reported cases of diseases under surveillance is a vast underestimate of the true burden, because most episodes of disease never reach the reporting systems, neither seeks medical care nor makes a specific diagnosis. Laboratories may not be well equipped with the appropriate tests to identify the causative pathogens. The major causative agents of these illnesses involve viruses, bacteria, parasites, toxins, metals, and prions. In particular, microorganisms, especially the bacteria, have become an important group of causative agents as most of morbidity and mortality from food borne illnesses are related to them (Nyenje et al., 2012). Colonization of these bacteria in human beings can cause a broad spectrum of food borne illnesses such as bacteremia, meningitis, urinary tract infection, septicemia, wound infection, central nervous system disorders and gastrointestinal tract disturbances (Ghosh et al., 2007). The food pathogens like Vibrio parahaemolyticus is one such organism as the infection may not cause high mortality. This bacterium was first identified as a cause of food-borne illness during the fall of 1950 within the southern suburbs of Osaka, Japan, where an outbreak of acute gastro enteritis following the consumption of semidried juvenile sardines sickened 272 and killed 20 individuals (Fujino et al., 1953). Vibrio parahaemolyticus has recently be recognized as one of the most important food borne pathogens as the leading causal agent of human acute gastro enteritis, primarily following the consumption of raw, under cooked or mishandled seafood and marine products (Su and Liu, 2007; Pal and Das, 2010 and Roman et al., 2012).
Materials and Methods
A total of 85 samples which includes 35 marine crabs sample (Tamil – Kadal nandu – 35 samples each) and human clinical samples (stool samples n=50) were collected from different fish vendors and markets in and around Puducherry. Human stools samples were collected from seafood vendors where the marine crabs were collected. The samples were collected in sterile plastic containers and transported to the laboratory for processing. An undertaking was taken from the individuals whose samples were collected. The details of sample collected including the place, type of sample, number of samples etc are given in Table 1.
Table 1: Details of samples collected
S. No. | Places in Puducherry | Crabs | Human Stool Samples |
1 | Ariyankuppam | 5 | – |
2 | Gubaran market | 5 | – |
3 | Kathirkamam | 5 | – |
4 | Mettupalayam | 5 | – |
5 | Pondy Town Market | 5 | – |
6 | Thavallakuppam | 5 | – |
7 | Govt. & Pvt. Hospital and Lab. | – | 50 |
Total | 35 | 50 |
Processing of Samples
The collected samples were processed in the Biosafety level–II laboratory facility available in the Department of Veterinary Public Health and Epidemiology, Rajiv Gandhi institute of Veterinary Education and Research, Kurumbapet, Puducherry. The crabs were washed with normal saline and then shell, claws and legs of crab were removed and then put into stomacher bag. In case of human stool samples, about 5 gram of the sample was directly added to the enrichment media. The samples remaining after the tests and negative samples were discarded as per standard methods including proper decontamination.
Isolation of Vibrio parahaemolyticus
Vibrio parahaemolyticus was isolated and identified as described in the Bacteriological Analytical Manual of the Food and Drug Administration (Elliot et al., 1995).
Selective Enrichment
The 50 grams of processed meat of sea food samples were placed in 450 ml of alkaline peptone water (APW) to obtain a 10-1 dilution. In case of human stool samples, 5 gram of the sample was enriched in 25 ml of APW and then it was incubated for 24 hours at 370C.
Selective Plating
A loop full of enrichment broth was streaked on to thiosulfate citrate bile salts sucrose (TCBS) agar plates and were incubated at 37°C for 24 hours. After the incubation, V. parahaemolyticus was observed as blue-green coloured colonies. This V. parahaemolyticus colonies (round, 1 to 2 mm in diameter, humid, shiny, sucrose fermenting,) was selected for biochemical tests. Human stool samples were also screened as per the method explained above.
Characterization and Identification of Isolates
The suspected colonies of V. parahaemolyticus were subjected to various tests and confirmed based on the biochemical characteristics. The individual colonies of V. parahaemolyticus from TCBS agar were transferred to TSB and incubated at 370C for 24 hours. Primary Identification Tests like Gram’s Staining, Catalase Test (Slide test), Oxidase Test and Motility Test were performed. Secondary Identification Tests like Indole production, Methyl Red (MR) Reaction, VogesProskauer (VP) Reaction, Citrate Utilization Test, Urease Activity, Gelatin Hydrolysis/ Liquefactions and Carbohydrate Utilization Test were preceded as per the standard procedures.
Differentiation between Vibrio parahaemolyticus and Vibrio vulnificus
Vibrio parahaemolyticus and Vibrio vulnificus are phenotypically similar, and difficult to differentiate. The differentiation between the Vibrio parahaemolyticus and Vibrio vulnificus were done as per the characteristic in the Table 2.
Table 2: Differentiation between Vibrio parahaemolyticus and Vibrio vulnificus
S. No. | Characteristics | Vibrio parahaemolyticus | Vibrio vulnificus |
1 | TCBS agar | Bluish green | Bluish green |
2 | Oxidase | Positive | Positive |
3 | Growth in 0, 3, 6, 8 and 10 per cent NaCl | Growth noticed in 3,6,8 and 10 per cent NaCl | Growth noticed only in 3 and 6 per NaCl |
4 | Acid from Sucrose | Negative | Negative |
5 | Acid from Lactose | Negative | Positive |
6 | Acid from Arabinose | Positive | Negative |
7 | Acid from D-mannitol | Positive | Variable |
Molecular Confirmation of the Isolates
After the isolation and biochemical characterization, Vibrio parahaemolyticus isolates were processed for further confirmation by tox R for Vibrio parahaemolyticus by Polymerase Chain Reaction (PCR).
Extraction of Template DNA
The DNA from Vibrio parahaemolyticus were extracted using Boil cell method. A single pure colony of bacterial culture was inoculated into five milliliter of Nutrient broth and incubated at 370C for 18 hrs. One point five milliliters of this broth culture was transferred to an eppendorf tube and centrifuged at 3000 rpm for 10 minutes. The pellet was washed twice in PBS and then it was resuspended in 100 µl of triple distilled water. This was boiled for 10 minutes and immediately chilled at -200C for 30 minutes. The sample was then thawed and centrifuged at 3000 rpm for 5 minutes. The supernatant which contained template DNA was stored at -200C till use. Five micro litres of the supernatant was used as template DNA for PCR. Bacterial culture lysate similarly prepared from the reference strain was used as template DNA for positive control in PCR.
Polymerase Chain Reaction (PCR) For the Detection of Vibrio parahaemolyticus
The following sets of primers were used for the detection toxR gene of V. parahaemolyticus (Kim et al., 1999) as shown in Table 3 and PCR reaction mixture for Vibrio parahaemolyticus is given in Table 4.
Table 3: Details of primers used
S. No. | Organism | Specificity | Primer | Primer Sequence (5’-3’) | Size |
1 | V.parahaemolyticus | nt 609-629 and 956-958 of a subunit coding for forward and reverse primer position of toxR |
toxR |
Forward 5’GTCTTCTGACGCAATCGTTG3′
Reverse 3’ATACGAGTGGTTGCTGTCATG5′ |
368bp |
Table 4: PCR reaction mixture for Vibrio parahaemolyticus
S. No. | Reaction Mixtures | Volume (µl) | |
1 | Template DNA | 2 | |
2 | Primers | Forward | 1 |
Reverse | 1 | ||
3 | Master mix | 10 | |
4 | Triple distilled water | 6 | |
Total | 20 µl |
The 20 µl reaction mixtures were prepared in 0.2 ml thin PCR tubes. The PCR amplification were carried out in an automated thermal cycler (Eppendroff mastercycler, Germany) using protocol in Table 5.
Table 5: The PCR protocol
S. No. | Steps | toxR Gene |
1 | Primary Denaturation | 94°C for 5 minutes |
2 | Denaturation | 94°C for 1 minutes |
3 | Annealing | 63°C for 1 minutes |
4 | Extension | 72°C for 2 minutes |
5 | Final Extension | 72°C for 7 minutes |
6 | No. of Cycles | 20 |
Submarine Agarose Gel Electrophorsis
The PCR products were analyzed by submarine agarose gel electrophoresis. Agarose (1.5 per cent) was dissolved in TAE buffer (1X) by heating. When the mixture was cooled around 500C, ethidium bromide was added to a final concentration of 0.5 µg/ml. Agarose was then poured into clean, dry, gel platform setup provided by Tarsons and the comb was kept in proper position. Once gel was set, comb was removed gently and the tray containing the gel was placed in the buffer tank. Buffer (TAE 1X) was poured till the gel was completely submerged. PCR product (10µl) was mixed with loading buffer (1µl of loading buffer per 5µl of the PCR product) and the samples were loaded in the wells. Then 100 bp DNA markers and positive and negative controls were loaded in separate wells. Electrophoresis was carried out at 5V/cm for one hour. The gel was visualized under UV transilluminator and the images were documented in a gel documentation system (Gel Doc It. Images System, UVP).
Bioflim Production Assay For Vibrio parahaemolyticus
Bioflim production in terms of slime production by isolates was determined by cultivation on Congo Red Agar (CRA) plates (Freeman et al., 1989 and Dadawala et al., 2010). A loop full of isolate was streaked onto CRA plates. The plates were incubated at 37°C for 24 hours followed by storage at room temperature for 48 hours. The production of rough black colonies by bacterial cultures indicated the ability for bioflim production.
Antibiogram
Antibiotic susceptibility tests were performed for V. parahaemolyticus according to the National Committee for Clinical Laboratory Standards (NCCLS, 2003). Premeasured antimicrobial discs were applied to the surface of Mueller-Hinton agar plates, previously seeded with each strain and commonly used antibiotics were used in this study.
Preparation of MAC Farland Standard
The turbidity standard solution was prepared by adding 0.5 ml of 0.048 M BaCl2 to 99.5 ml of 0.36 N H2SO4 (one per cent w/v). This solution is equal to half the density of No.1 Mac Farland standard solution. This solution was taken into glass tube, sealed tightly and kept in the dark, at room temperature for further use. The tube was vigorously agitated just before each use.
Preparation and Standardization of Inoculum
Three to four isolated colonies were selected from a pure culture and transferred into sterile nutrient broth and incubated at 370C, overnight. The turbidity of culture was adjusted using solution having half the density of Mac Farland standard No.1. When the broth culture was found to be more turbid, it was diluted with nutrient broth and when the turbidity was found to be less, culture was incubated for more time to achieve the required turbidity.
Inoculation
The swab was dipped into standardized inoculum and excess inoculum was removed from the swab by rotating it several times with a firm pressure on the inside wall of the test tube, above the fluid level. The sterile Mueller Hinton agar (Hi-Media) plates were inoculated by swabbing over its entire surface, within 15 min. after adjusting the density of inoculum. The swabbing procedure was repeated two more times, rotating the plates approximately 600 at each time, so as to ensure an even distribution of inoculums. The inoculums were allowed to dry for 15 min.
Application of Antibiotic Discs
The inoculated plate was left for not more than 15 min. at room temperature to absorb any excess surface moisture before applying the drug impregnated discs. The discs were applied to the surface of the inoculated agar with a sterile forceps. With the tip of the forceps, each disc was gently pressed down to ensure complete contact with the agar surface. During the application of discs care was taken not to place it closer than 15mm from the edge of the plate and the distance between the centre’s of two such discs was not less than 24mm. The inoculated plate was inverted and incubated at 370C for 18 hours after the application of the discs. In this study, 15 locally available antibiotic discs were tested against both E. coli and Vibrio parahaemolyticus isolates. The isolates were tested against Ampicillin (10 mcg), Amoxyclav (30 mcg), Amikacin (30 mcg), Azithromycin (30 mcg), Chloramphenicol (30 mcg), Cotrimazole (10 mcg), Ciprofloxacin(30 mcg), Cefotaxime (30 mcg), Gentamicin (30 mcg), Metronidazole (50 mcg), Nalidixic acid (30 mcg), Penicillin-G (10 units) Sulphamethiozole (300 mcg), Trimethoprim (25 mcg), Tetracyclin (30 mcg), Polymixcin B (300 units) antibiotic discs.
Results and Discussion
Isolation of Vibrio parahaemolyticus
All the samples collected were subjected to isolation of Vibrio parahaemolyticus by conventional culture technique. Species level differentiation was carried out using carbohydrate utilisation test.
Marine Crab Samples
Out of 35 marine crabs screened, 20 samples had colonies with characteristics of V. parahaemolyticus in TCBS agar. Out of 35, 20 (57.14 per cent) of marine crab samples were positive for V. parahaemolyticus. An overall presence of 57.14 per cent was observed among the seafood. When compared to this a study by Sanjivikumar et al. (2009) revealed lower prevalence of V. parahaemolyticus. They obtained 3 (6.0 per cent) V. parahaemolyticus isolates from 50 sea fish samples when they screened Sardine fish from Puducherry. The incidence of V. parahaemolyticus in seafood had been reported from crabs as 9.3 per cent (Rahimi et al., 2010), and 11 per cent from retail shrimp (Zarei et al., 2012).
Higher prevalence of V. parahemolyticus was observed in a study done by Fishbein et al. (1970). They reported 25 (41.67 per cent) V. parahaemolyticus isolates from 60 Chesapeake Bay crabs. Vibrio parahaemolyticus were isolated from 51 (94 per cent) of 54 shellfish samples, 25 (83 per cent) of 30 shrimp samples, and 22 (73 per cent) of 30 fish samples by Vuddhakul et al. (2000). Kudo et al. (2003) found that 173 (52.58 per cent) sea fish samples were positive for V. parahaemolyticus. These studies were showing comparatively higher prevalence than the present study. Similarly, Odeyemi, (2016) also observed higher prevalence of V. parahaemolyticus when they obtained 2671isolates (47.5 per cent) from 5811 of seafood samples.
Human Stool Samples
Out of 50 human stools sample 2 samples showed typical colonies with characteristics of V. parahemolyticus in TCBS agar. The details of suspected Vibrio parahaemolyticus isolates from the marine crabs and human clinical samples are shown in the Table 6. The growth of suspected V. parahaemolyticus isolates in different solid medias are shown in the Plate 1. However all these isolates were subjected to various biochemical tests for further confirmation.
Table 6: Details of Vibrio parahemolyticus from marine crabs and human stool samples
Samples |
Gubar market | Kathirkamam | Kurumbapet | Mettupalayam | Nellithoppu | Pondy town market | Thavalakuppam | Villianur | No. of Positive samples | Per cent |
Marine crab | 3 | 3 | 0 | 3 | 3 | 3 | 2 | 3 | 20/35 | 57.14 |
Human stool | 2 | 02/50 | 04.00 | |||||||
Total | 22/85 | 25.88 |
Food borne disease caused by V. parahaemolyticus is rarely reported from Asian countries. This is due to the self limiting nature of infection and lack of confirmatory diagnosis. However, the increase in consumption of raw or undercooked seafood and the phenomenon of global warming and increased water temperature has led to increased concern about V. parahaemolyticus and the enhanced risk of V. parahaemolyticus infection. In this study 2 (4.0 per cent) isolates were obtained from human diarrhoea cases. In Galicia, Northern Spain, in 1999, an outbreak of 64 cases of V. parahaemolyticus gastroenteritis was recorded by Lozanoleón et al. (2003). In 2004, another outbreak of 80 cases in Spain has been reported by Urtaza et al. (2005). Depaola et al. (2000) reported two outbreaks in Texas (416 cases) and in Washington (43 cases). Bhoopong et al. (2007) found that 6.5 per cent to 10.9 per cent of clinical specimens were positive for V. parahaemolyticus. The prevalence of V. parahaemolyticus was 4.2 per cent in 2009 at Kolkata when they screened human stool samples from diarrhea cases (Pazhani et al., 2014).
TCBS agar | Blood agar | Muller Hinton agar |
Plate 1: Growth of V. parahaemolyticus isolates in different solid media
Biochemical Tests for V. parahaemolyticus
When subjected to biochemical tests, it was found that all these isolates were positive for catalase test, oxidase test, motility, indole production and urease test. These isolates were negative for MR, VP and citrate utilisation. The results of these tests clearly indicated that they belonged to Vibrio species. These isolates were then subjected to carbohydrate utilisation tests for identification of species. The results suggested that out of 22 isolates only 16 isolates (14 from marine crabs and 2 from human stools) were showing reaction similar to that of Vibrio parahaemolyticus. Remaining 6 isolates were showing characteristics of Vibrio vulnificus. The details about the various biochemical tests of suspected Vibrio parahaemolyticus isolates are given in the Table 7.
Table 7: Biochemical characteristics of Vibrio parahaemolyticus isolates from marine crabs and human stool samples
Sam. | Marine crabs | Human stool | ||||||||||||||
Test | 1 | 2 | 3 | 7 | 8 | 10 | 11 | 15 | 20 | 23 | 24 | 27 | 30 | 32 | 12 | 48 |
Shape | R/C | R/C | R/C | R/C | R/C | R/C | R/C | R/C | R/C | R/C | R/C | R/C | R/C | R/C | R/C | R/C |
Cat. | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + |
Oxi | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + |
Mo | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + |
I | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + |
MR | – | – | – | – | – | – | – | – | – | – | – | – | – | – | – | – |
VP | – | – | – | – | – | – | – | – | – | – | – | – | – | – | – | – |
Ci | – | – | – | – | – | – | – | – | – | – | – | – | – | – | – | – |
TSI | – | – | – | – | – | – | – | – | – | – | – | – | – | – | – | – |
U | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + |
N | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + |
Ly. | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + |
D-glu. | + | + | + | + | + | + | + | + | + | + | + | + | + | ++ | + | + |
Lac. | – | – | – | – | – | – | – | – | – | – | – | – | – | – | – | – |
Sor. | – | – | – | – | – | – | – | – | – | – | – | – | – | – | – | – |
Suc | – | – | – | – | – | – | – | – | – | – | – | – | – | – | – | – |
D-man | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + |
In | – | – | – | – | – | – | – | – | – | – | – | – | – | – | – | – |
Mal | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + |
Cel | – | – | – | – | – | – | – | – | – | – | – | – | – | – | – | – |
Ar | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + |
R : Rod shaped, C: Curved, + : Positive, – : Negative, Cat: catalase test, Oxi: Oxidase test, Mo: Motility test, I: Indole production, MR: Methyl Red, VP: Voges Proskauer, Ci: Citrate utilization test, TSI: Triple Sugar Iron agar reaction, U: Urease test, N: NaCl tolerance test, Ly: Lysine decarboxylase test, D-glu: D-glucose, Lac: Lactose, Suc: Sucrose, Sor: Sorbitol, D-man: D-mannitol, In: Inositol, Mal: Maltose, Cel: Cellobiose, Ar: Arabinose, Sam: Samples; Ch: Chevon
Detection of tox R Gene of Vibrio parahemolyticus by PCR
After the biochemical characterization and identification, all 16 isolates (14 from marine crab and 2 from human stools) were screened by PCR for detection of toxR gene. All the 16 isolates were showing the presence of toxR gene (Fig. 1). The tox R transmembrane protein encoded by the toxR gene is concerned with the regulation of genes in Vibrio species. Kim et al. (1999) developed a specific PCR to target the toxR gene to identify V. parahaemolyticus. Rosec et al. (2009) had reported that the PCR targeting the toxR gene is an efficient and reliable tool for the identification of V. parahaemolyticus. Based on this reports, in the present study after the biochemical characterization and identification, all 16 isolates (14 from marine crab and 2 from human stools) were screened by PCR for detection of toxR gene. All the 16 isolates were showing the presence of toxR gene by the amplification of 368 bp products. Similarly Kim et al., 1999 performed PCR for V. parahaemolyticus toxR gene, on 373 strains of V. parahaemolyticus and all were positive for toxR gene. Pal and Das (2010) conducted a study on 90 fish samples and found that 66.7 per cent isolates were positive for V.parahaemolyticus with presence of toxR gene.
Fig.1: PCR profile of Vibrio parahaemolyticus isolates for toxR gene
L1- 100 bp molecular marker, L2- negative control, L3- positive control, L4 to L10- toxR gene at 368 bp from positive samples.
Biofilm Production Assay
In biofilm production assay of Vibrio parahaemolyticus by using the modified Congo Red Agar (mCRA), out of 14 isolates of V. parahaemolyticus from marine crab samples 9 (64.29 per cent) and none of the isolates from human stool samples were having the ability of biofilm production. The results, developed in this study, showed that Vibrio, food-borne pathogen, is able to produce biofilm on abiotic surface.
Almost same type of results was noticed in a study by Elexson et al. (2014) in Malaysia isolated a total 36 strains of V. parahaemolyticus strains from seafoods and screened for the in vitro biofilm formation in the wells of commercially available microtiter plates. The biofilm production was measured at room temperature and at the end it had 61.1 per cent of weak biofilm producers, 13.89 per cent of moderate biofilm producers and 25 per cent of strong biofilm producers. Chari et al. (2014) reported 14.0 per cent of Vibrio isolates had biofilm producing ability in congo red agar and was lower than the present study.
Antibiogram of the Vibrio parahemolyticus Isolates from Marine Crabs and Human Stool Samples
All the 16 isolates of the Vibrio prahaemolyticus from the marine crabs and human stools samples were subjected to the Antibiotic Sensitivity (ABST) by disc diffusion method with 16 antibiotics. The detailed antibiogram of the isolates from marine crabs and human stool samples are summarized in the Table 8 and percentage wise antibiogram of V. parahemolyticus isolates from marine crabs and human stools samples were shown in Fig. 2 and 3 respectively.
Table 8: Antibiogram of Vibrio parahaemolyticus isolates from marine crabs and human stool samples
S. No. | Samples | Marine Crabs | Human stool | ||||||||||||||
1 | Isolates no | 1 | 2 | 3 | 7 | 8 | 10 | 11 | 15 | 20 | 23 | 24 | 27 | 30 | 32 | 12 | 48 |
2 | Amipicillin | S | R | I | S | R | R | I | R | S | I | R | I | R | S | R | R |
3 | Amoxyclav | S | I | I | I | I | I | I | I | S | I | I | I | I | S | I | I |
4 | Amikacin | R | S | R | R | R | R | I | S | R | R | R | R | R | I | I | R |
5 | Azithromycin | I | R | I | S | R | R | R | R | R | S | I | R | R | R | I | R |
6 | Chloramphenicol | S | I | I | S | I | R | I | R | I | I | S | I | S | I | S | I |
7 | Cotrimazole | R | R | R | R | S | S | I | S | S | S | I | I | R | R | R | R |
8 | Ciprofloxacin | S | R | I | S | S | S | I | I | I | S | R | I | I | R | I | S |
9 | Cefotaxime | I | S | R | R | S | I | S | I | S | I | S | S | R | I | I | I |
10 | Cefazolin | S | I | I | I | S | S | R | R | R | S | I | I | S | S | S | R |
11 | Gentamicin | S | I | R | S | R | S | I | S | S | S | R | R | S | S | S | I |
12 | Metronidazole | S | R | R | S | R | S | S | R | I | S | R | I | R | R | S | R |
13 | Moxifloxacin | S | I | S | R | S | I | S | R | I | R | I | S | S | S | I | S |
14 | Nalidixic acid | I | R | I | R | I | S | I | R | R | I | I | I | I | S | R | R |
15 | Sulphamethazole | S | R | R | S | R | I | S | R | I | R | S | R | I | R | R | S |
16 | Trimethoprim | R | S | R | S | I | S | S | R | R | I | R | S | S | S | I | S |
17 | Tetracyclin | S | I | R | S | I | R | S | R | S | R | S | R | I | I | R | R |
S: Sensitivity, R: Resistance, I: Intermediate
Fig. 2: Percentage wise antibiogram of V. parahaemolyticus isolates from marine crabs samples
All the 30 isolates of V. parahaemolyticus showed sensitivity to most of the antibiotics used in this test. The 14 isolates of V. parahaemolyticus from the marine crabs showed sensitivity to cefotaxime, cefazolin (42.86 per cent), moxifloxacin, trimethoprim (50 per cent) and gentamicin (57.14 per cent). Large number of isolates showed resistance against amikacin (71.43 per cent), followed by azithromycin (64.29 per cent), sulphamethazole (50 per cent) and amipicillin, cotrimazole and metronidazole (42.86 per cent). Intermediate action was shown by the isolates towards amoxyclav (78.56 per cent), cholramphenicol (57.14 per cent), ciprofloxacin (42.86 per cent) and nalidixic acid (64.29 per cent). A total of 2 isolates of V. parahaemolyticus were isolated from the human clinical stool samples, in that all the isolates did not show a complete sensitivity to those antibiotics used in this study but these isolates showed combined pattern of results. One isolate was sensitive to antibiotics like cholramphenicol, ciprofloxacin, gentamicin, moxifloxacin and trimethoprim while other isolate showed intermediate action against these antibiotics. All the V. parahaemolyticus isolates from the human clinical stool samples were resistant to antibiotics, amipicillin, cotrimazole, nalidixic acid and tetracycline.
Fig. 3: Percentage wise antibiogram of V. parahemolyticus isolates from human stools samples
In the present study a total of 16 isolates of V. parahaemolyticus were subjected to antibiotic sensitivity test. In that 74.07 per cent of isolates showed resistance to amikacin followed by 59.26 per cent of isolates showing resistance to azithromicin, 55.56 per cent of isolates showed resistant to metronidazole and 51.85 per cent of isolates were resistant to amipicillin, sulphamethazole and tetracycline. Eleven per cent of the isolates were resistant to ciprofloxacin, 7.41 per cent of isolates were resistant to chloramphenicol and 3.7 per cent of isolates showed resistance to amoxyclav. In a study conducted in Nigeria Adeleye et al. (2008) observed that the V. parahaemolyticus isolates from seafood in Lagos, Nigeria were resistant to amipicillin, chloramphenicol, cotrimozazole, ceftriazone, ciprofloxacin and tetracycline. In a study by Rojas et al. (2011) 19 isolates obtained from oysters and mussels, were found susceptible to nalidixic acid and cefazoline. Pazhani et al. (2014) reported that, 98 per cent (174/178) of the strains of V. parahaemolyticus from diarrheal patients in Kolkata, India were resistant to ampicillin, followed by 3.4 per cent to nalidixic acid, and 1.7 per cent to chloramphenicol. Shaw et al. (2014) screened V. parahaemolyticus isolates from recreational and commercial areas, and found that the isolates showed intermediate resistance to chloramphenicol (96 per cent), followed by ampicillin (25 per cent) and cefataxim (17 per cent). A high per cent of resistance was observed against ampicillin (53 per cent), while a low per cent of resistance was seen against gentamicin (4 per cent). Letchumanan et al., 2015 reported antibiotic resistance for V.parahaemolyticus isolates with 88 per cent isolates resistant to ampicillin, followed by 81 per cent to amikacin and 73 per cent to cefotaxime. Susceptibility testing for V. parahaemolyticus was performed by Krohn et al. (2016) revealed the organism to be susceptible to all of the antibiotics tested. Those antibiotics were Amikacin, Ciprofloxacin, Gentamicin, and Trimethoprim-sulfamethoxazole. The results of antibiotic resistance profiling of the V. parahaemolyticus isolates does not show high resistance.
Conclusion
Results of this present study show that higher prevalence of V. parahaemolyticus was noticed in the marine crabs samples is in the expected lines as marine environment habours the organism. The marine crabs had higher level of V. parahaemolyticus. This may be due to the peculiarity of marine crabs as they are bottom feeders and filter feeders. This can lead to high intake of organisms which are commonly found in the bottom. The results also show proper care should be taken while cooking of seafood, especially when it is fed to children and immune compromised people. Also proper care should be taken when exotic seafood preparation with least or no cooking is consumed. It is also important that in kitchen when ever seafood is prepare, care shall be taken to avoid cross contamination.
References