NAAS Score 2020

                   5.36

UserOnline

Free counters!

Previous Next

Diagnosis of Mycobacterium bovis Using Interferon-gamma (IFN-γ) Assay and Post Mortem in Indian Cattle (Bos indicus)

Sanjeev Kumar Shukla Shubhra Shukla Anuj Chauhan Sarvjeet Kumar Rajveer Maurya Sudesh Rathaor Lakshya Veer Singh Manjit Panigrahi
Vol 7(9), 148-158
DOI- http://dx.doi.org/10.5455/ijlr.20170710032441

Bovine tuberculosis (bTB) is a major economic problem in animal husbandry. The aim of this study, we evaluated the capability of the interferon-gamma (IFN-γ) assay to identify cattle infected with Mycobacterium bovis. A total of one hundred sixty nine randomly selected animals, one year and above were studied for the prevalence of bovine TB using Single Intradermal Comparative Cervical Tuberculin (SICCT) Test, Bovine Gamma-Interferon (γ-IFN), Polymerase Chain Reactions (PCRs) and Post-mortem based examination. The collected blood samples for IFN testing simultaneous with the SICCT, as well as seven and twenty one day later. All selected cattle samples were processed polymerase chain reaction and got 248 bp amplification. In the diagnostic tool the sensitivity of IFN was 94.7%, while the specificity was 89.9%. After injection of PPD applied seven or twenty one days, the sensitivity was 76.6 and 74.7%, respectively, whereas the specificity was 89.9 and 83.3%. Post mortem examination was done by the experts of M. bovis infected twenty five animals and we got eight positive. Detection of cattle tuberculosis can be done in early stage in live animals with most realistic approach like IFN-γ assay, PCR and post-mortem examination to accelerate the eradication process, therefore, more studies should be performed to further improve them.


Keywords : Cattle Interferon Gamma Assay Mycobacterium bovis Tuberculin Skin Test

Introduction

The organisms responsible to cause tuberculosis in mammals are gram-positive acid fast bacteria belonging to the Mycobacterium Tuberculosis Complex (MTC) which includes M. tuberculosis, M. bovis, M. africanum, M. microti, M. canetti, M. caprae (Aranaz et al., 2004). Bovine tuberculosis (bTB), which is caused by M. bovis, represents a contagious chronic disease in cattle that is characterized by the formation of granulomatous lesions generally in the lungs and associated lymph nodes (Aranday-Cortes et al., 2012). It was estimated that 40% of dairy cows were infected and M. bovis was thought to be responsible for around 2000 human deaths per annum (Krebs et al., 1998). In countries without control policies around 10% of human TB cases are M. bovis related and those with concomitant HIV/AIDS and bovine tuberculosis infection are particularly at risk (Gutaa et al., 2014). The most common diagnostic method, based on intradermal tests, has limitations regarding both sensitivity and specificity (Monaghan et al., 1994). In industrialized countries these schemes rely mainly on the removal and slaughter of bovines identified as infected. The most widely used diagnostic techniques to perform intra-vitam diagnosis of M. bovis infection in cattle are the in-vivo intradermal tuberculin test (IDT) and the in-vitro interferon (IFNγ) assay (Rua-Domenech et al., 2006). Detection of IFN-γ for latent tuberculosis diagnosis using by capacitive sensor (Kim et al., 2014).

Bovine tuberculosis has also been diagnosed by measuring the immune response of cattle to M. bovis infection and in bovine tuberculosis risk factor is also there in the herds. Among the immunodiagnostic assays developed, the intradermal tuberculin technique has been the most extensively used worldwide. The cellular infiltrates and macrophage activation pathways may differ in granulomas found in the lungs and pulmonary lymph nodes of cattle infected with M. bovis. The tuberculin used for the skin test is a purified protein derivative (PPD) prepared from culture filtrate of a laboratory strain of M. bovis (Francis et al., 1978). This test, based on the measurement of cellular immune response, can be conducted by inoculation into either the caudal fold near of the base of the tail or in the shoulder, both as a single (inoculation with only bovine tuberculin) or a comparative assay (inoculation with both bovine and avian tuberculin into opposite sites of either the shoulder or the caudal fold (McGilla et al., 2014).

The different susceptible animal species may act either as maintenance host (reservoir) or as non-maintenance host (spillover) (Aranaz et al., 2004). Because of its zoonotic potential and its problem on livestock health, M. bovis has been the target of specific eradication plans aimed to control the infection and Mycobacterium bovis infections in domesticated non-bovine mammalian species and wild species (Broughan et al., 2013).The PPDs used in the IFN-γ and skin tests are prepared from heat-inactivated culture filtrates of mycobacteria and are poorly defined, complex antigens containing many individual proteins (Andersen et al., 1994). The IFN- γ measures the Gamma-IFN released in-vitro in response to specific antigens in whole blood culture (Wood et al., 1990). A particular advantage of the test is that the interpretation criteria for defining a positive IFN-γ reactor can be readily adjusted so as to change both the sensitivity and specificity of the assay, depending on the application of the test (Monaghan et al., 1994). One Chines team established Generation and application of a 293 cell line stably expressing bovine interferon-gamma (Xu et al., 2014).The aim of this study is, therefore to evaluate based on IFN-γ assay, PCR and post-mortem based for detection of M. bovis infected cattle. PPD treatment as a positive test in a reasonably infected dairy group in India on the basis of blood samples collected seven and twenty one days.

Material and Methods

Animals

Fifty randomly selected animals, Kosi, Gir, Sahiwal, Deoni and Rathi from dairy farm of Barsana, Mathura, Uttar Pradesh were selected for this study. All animal procedures were approved by animal ethics committee of Institute. The Single Intradermal Tuberculin Test (SITT) had positive reaction in twenty five adult’s cows and for positive tests these animal kept in separation for ninety days. The Comparative Intradermal Tuberculin Test (CITT) in group one was completed in twenty five cows after ninety days and for negative test of SITT test in group two were in casually twenty selected cows. The collected blood samples from fifty cows for IFN testing, at the time of the CITT, and seven and twenty one days later. After injection of PPD at thirty days in all fifty cattle, blood sample were collected for the study of PCR.

IFN Testing

SITT and CITT both tests are intradermal for tuberculosis diagnosis was performed on all fifty cows. The SICTT was conducted by intradermal injection in the cervical area of each cow with 0.1 ml (1 mg/ml) of bovine PPD. The skin thickness was measured with callipers before the intradermal injection and at 72 h post-injection if a swelling >4.0mm occurred at the injection site. The CITT consisted of the same procedure with 0.1 ml (1 mg/ml) of avian PPD in the cervical area of cow. A positive response was defined as an increase in skin thickness at the bovine PPD site of 4 mm or greater than the increase in skin thickness at the avian PPD site. Reported that, in a practical sense, location of the PPD sites is of great importance and the middle and anterior third of the neck is recommended (Cagiola et al., 2004; Good et al., 2011). However, the avian and bovine PPD measurements were not significantly different when sites anterior or posterior to this were chosen (Fig. 1) (Table 1).

IMG-20150225-WA0048

Fig. 1: Intradermal tuberculin test in T.B. infected cattle

Table1: Criteria for interpretation of reactions of the intradermal tests and IFN-g assay used in this study according to European and Spanish legislation (EU Council Directive 64/432/CEE and R.D. 2611/1996)

Experiment Name Severe Interpretationa Standard Interpretationb
Single Intradermal Comparative Cervical Tuberculin

Test (SICCT)C

Negative reaction: Bovine difference minus avian difference is < 1 mm and no clinical signs are observed Negative reaction: Bovine difference minus avian difference is < 1 mm and no clinical signs are observed Inconclusive reaction: Bovine difference minus avian difference is 1 and 4 mm and no clinical signs are observed
Positive reaction: Bovine difference minus avian difference is 1 mm and/or clinical signs are present. Positive reactione: Bovine difference minus avian difference is > 4 mm and/or clinical signs are present.
IFN-γ assay Negative animal: Bovine optical density (OD) – PBS OD < 0.05 and/or bovine OD – PBS OD < avian OD – PBS OD
Positive animal: Bovine OD – PBS OD 0.05 and bovine OD – PBS OD must be higher than avian OD – PBS OD

aSevere interpretation: used in geographical areas with high prevalence and in herds with confirmed M. bovis infection; bStandard interpretation: used in geographical areas with low tuberculosis prevalence and in herds with absence of M. bovis infection (unless they are situated in geographical areas with high prevalence). CSICCT, single intradermal comparative cervical tuberculin test. Results are recorded increase(s) in skin-fold thickness at the sites of injection 72 h after.

IFN-γ assay

The in-vitro IFN-γ assay developed in Australia in the late 1980s recommended by the OIE since 1996 (OIE Terrestrial Manual) as ancillary laboratory-based test to the tuberculin intradermal test (OIE et al., 2001). Most of the bovine TB control programmes rely on the use of BOVIGAM (Prionics, Switzerland) as parallel test to the intradermal test to maximise the detection of TB-infected animals. The assay is accepted for use as ancillary test to the intra-dermal test. Blood samples were collected in heparinised vaccutainer tubes and immediately stored in thermal boxes to prevent the blood from exposure to temperature fluctuations during sample collection and transportation. Culture of blood with antigens was initiated within 8-12 h of sampling wells of a 48 well culture plate (Greiner Bio-one, Heidelberg, Germany). 0.5 mL whole blood was cultured with either 50 µl antigen, positive or negative control solution separately for 20–22 h at 370C in 5% CO2. Antigen solutions were 10 µg/m 1 µg/ml Antigen 85B (Ag85B) and 1 µg/ml of one of 14 novel recombinant antigens: As a positive control 1 µg/ml of superantigen Staphylococcal enterotoxin B (SEB) was used and as a negative control phosphate buffered saline (PBS) was used in parallel cultures. All antigens and the positive control were diluted in PBS. Following overnight culture, the culture plates were centrifuged and the supernatants collected and stored below -20oC until further analysis. The antigen specific IFN-γ production in supernatants was determined by an in-house monoclonal sandwich ELISA as described in detail previously (Mikkelsen et al., 2009). The level of IFN-γ (pg/ml) was calculated using linear regression on log–log transformed readings from the twofold dilution series of a reference standard with known IFN-γ concentration.

Performance of the Intradermal Test

Some immunological factors (early infection, energy or concurrent immunosuppression), factors related to the PPDs (expired product, product stored under inappropriate conditions, manufacturing errors, low potency) or to the methodology (doses, site of injection, inexperience) might cause false negative results (De la Rua-Domenech et al., 2006). On the other hand, co-infection or pre-exposure to other related non-tuberculous mycobacteria is a potential cause of a false positive result due to the similar antigenic composition of these bacteria (Humblet et al.,2011).

Production and Measurement of Interferon-Gamma Assay Testing

Heparinised blood (1.5 ml) samples were collected from jugular vein of fifty cattle just prior to injection of PPD, as well as seven and twenty one days later. The cultures were incubated for 24 h at 37oC and the IFN-γ levels in the plasma supernatants were measured using a sandwich ELISA kit (Bovigam, Prionics, Zurich, Switzerland) as described previously (Rothel et al., 1990). The results were interpreted according to the criteria described in the commercial kit instructions.

Statistical Analysis

Sensitivity of the different diagnostic techniques was calculated using as gold standard the isolation and/or microscopic detection of Mycobacteria in the lesions. The agreement between the diagnostic techniques was established by the Kappa index. The association between the results of the diagnostic techniques and the different parameters studied was examined using the Pearson Chi square test. Analyses were performed using SPSS 19.0 software (IBM, Armonk, NY, USA). AP-value of < 0.05 was considered to be statistically significant.

Post-mortem Examination of Cattle

Post-mortem examination was performed in such a way that the lungs and lymph nodes were removed for the investigation of tuberculous lesions, the seven lobes of the two lungs including the left apical, left cardiac, left diaphragmatic right apical, right cardiac, right diaphragmatic and right accessory lobes, were inspected externally and palpated (Hope et al., 2005; Vordermeier, et al., 2002). Where lesions consistent with tuberculosis were found then sectioned into about two centimetre thick slices for bacteriology and histopathology examination. Suspected lesions were fixed in 10% formol saline embedded in paraffin and 5 gm thick sections cut from each block were stained with Harris’s haematoxylin and eosin.

IMG_0966

Fig. 2: Photograph of the M. bovis affected cattle showing during post mortem examination of slaughtered cattle

PCR Amplification of Mycobacterium

Tissue samples (mesenteric and ileocecal lymph nodes) of all animals were pooled for PCR of M. bovis. Briefly, DNA for PCR analysis was extracted from 20 mg of frozen tissue samples with the QIAGEN DNA isolation kit (QIAGEN) according to the manufacturer’s instructions. The DNA was quantified at 280 nm using a Nanodrop 1 (Thermo Scientific, USA). Oligonucleotide Forward primers used (5’- GAGTAGGTCATGGCTCCTCC – 3’) Reversed Primer (5’-CATGCACCGAATTAGAACGT – 3’) was initially used to differentiate between M. tuberculosiscomplex, M. bovis and M. avium complex as originally described (Coetsier et al., 2000). PCR reaction mixture contained a 25µl PCR Master Mix 2X (Thermo Scientific, USA), ultra-pure water (Millique), 1µM of each primer and 1 µl of the extracted DNA. Amplification reactions were performed on a Thermal cycler (Bio-Rad Laboratory, USA) and amplification cycle consisted of 5 min denaturation at 95°C followed by 30 cycles of denaturation at 94°C for 1 min; annealing at 50°C for 1 min, extension at 72°C for 1 min and a final extension at 72°C for 10 min. PCR amplification was confirmed by electrophoresis using 2µl of PCR product on 1% agarose gel stained with ethidium bromide and visualization under UV light (Bio-Rad Laboratory, USA) (Fig. 3). Negative controls (PCR analysis without DNA template) were used to detected possible contamination in tissues and M. bovis isolates from cultures as positive controls. No contamination was detected in the samples.

X

Fig.3: PCR Amplification by M. bovis DNA target a 248 bp region of IS1081 Lane M: 100 bp DNA ladder; Lane 1-4: M. bovis PCR Amplification by using tissue sample; Lane 5: Positive control; Lane 6: Negative control.

Results

Accuracy of the and IFN-g Tests

IFN-γ is predominantly produced by natural killer cells, while the Th1, CD4 and CD8 cytotoxic T lymphocyte effector T cells can produce IFN-γ when antigen-specific immunity has developed (Schoenborn et al., 2007). As the only type II IFN-γ, IFN-γ is important for innate and adaptive immunity against viral and intracellular bacterial infections and for tumor control. Recently, mastitis, foot and mouth disease, bovine tuberculosis and other cattle diseases have resulted in serious damage to the dairy farming industry; IFN-γ could potentially be used to control these diseases. In the diagnostic tool the sensitivity of IFN was 94.7%, while the specificity was 89.9%. After injection of PPD applied seven or twenty one days, the sensitivity was 76.6 and 74.7%, respectively, whereas the specificity was 89.9 and 83.3%. It also focuses the need for an additional test to improve recognition of diseases cattle. The comparatively superior results of the ELISA for the detection of advanced forms of tuberculosis and the complementarity observed when used with the comparative skin test make the IFN-ELISA a suitable ancillary technique to improve eradication programmes. The serological tests are useful for the analysis of tuberculosis in cattle has been undervalued associated with tests to determine cellular immunity, the detection of specific antibodies has been demonstrated by this and other studies, to be a useful diagnostic tool for tuberculosis in cattle (McGilla et al., 2014).

The process of post-mortem examination is not perfect for the detection of infections with M. bovis. In the infected herd of the cattle up to 30% animals can become infected with bTB (Phillips et al., 2003). Cattle with an effective innate immune response may clear an infection with M. bovis. In that event, those cattle might test positive by IFN-γ and ELISA assay but lack lesions at post-mortem examination and be negative for M. bovis on bacterial culture (Pollock et al., 2005). Similarly, cattle in an early stage of infection with M. bovis may test positive by IFN-γ and ELISA assay but lack lesions at post-mortem examination and be negative on cultures for M. bovis and latent infection is known to occur in humans infected with M. tuberculosis (Rebecca et al., 2014; Casal et al., 2014). It is believed that latent bTB infection can occur in cattle, it is likely that some latently infected cattle would test positive by IFN-γ and ELISA assay but lack lesions at post-mortem examination and be negative on cultures for M. bovis (Juan et al., 2014).

It has been shown that there is a positive correlation between production of IFN-γ in peripheral blood cells and disease progression (Vordermeier et al., 2002) in this work we have not observed a direct correlation between IFN-γ production in peripheral blood cells and level of pathology. It is possible that this lack of correlation could be due to co-infection or to the fact that the number of animals is very small. Moreover, some animals with small lesions showed greater production of IFN-γ than animals with extensive necrosis, in this case lower production of IFN-γ would indicate a reduced activation of macrophages promoting the development of caseous lesions with extensive necrosis. In the future, these early stage secreted antigens could potentially be applied for diagnosis of active bovine tuberculosis.

Post-mortem Examination of Cattle

In post-mortem examination, twelve positive samples, eight negative samples and three doubtful were found. Only positive animal samples were collected based on the results of histologic examination and microscopic examination. Twelve positive samples of the infected cattle had evidence of tuberculosis in the liver, lung and medial retropharyngeal lymph nodes.

PCR Amplification of Mycobacterium

After initial screening, M. bovis specific PCR targeting 248 bp. Positive and negative controls (without target DNA) were also run simultaneously with test samples (Fig. 3).

Discussion

Diagnosis of bovine TB has certain limitations associated to the immunological response against the infection and to the accuracy of the current diagnostic tools that are more evident at the final steps of the eradication process. The intradermal tuberculin test has demonstrated to be an adequate diagnostic tool at herd level, and several countries have achieved the eradication based on this test. The inclusion of the IFN-γ assay for use in infected herds in parallel with the intradermal test has demonstrated to be an adequate methodology to maximize the detection of infected cattle and to accelerate the eradication process. The use of both assays is the most realistic approach for diagnosis of bovine TB in the near future and, therefore, more studies should be performed to further improve them. Diagnosis of bovine TB has certain limitations associated to the immunological response against the infection and to the accuracy of the current diagnostic tools that are more evident at the final steps of the eradication process. The intradermal tuberculin test has demonstrated to be an adequate diagnostic tool at herd level and several countries have achieved the eradication based on this test.

Diagnosis based on detection of specific Abs could be ancillary in any case since the Se achieved by the current assays under field conditions is, in general, lower than that achieved using the official diagnostic assays. The performance of the serological assays is mainly affected by the irregular and in general, late pattern of antibody production reported in the humoral response against TB. Nevertheless, the difficulties to achieve the eradication of bovine TB in certain regions or countries should not be focused only to the limitations of the current diagnostic assays or to the epidemiological conditions (presence of wildlife or infection with other nontuberculous mycobacteria). In this line of thought, other factors related to the practices of all stakeholders involved (private and government veterinarians, managers herd owners) should be addressed, evaluated and improved if necessary.

Conclusion

Diagnosis based on detection of specific Abs could be ancillary in any case since the Se achieved by the current assays under field conditions is, in general, lower than that achieved using the official diagnostic assays. The performance of the serological assays is mainly affected by the irregular and in general, late pattern of antibody production reported in the humoral response against TB. Nevertheless, the difficulties to achieve the eradication of bovine TB in certain regions or countries should not be focused only to the limitations of the current diagnostic assays or to the epidemiological conditions (presence of wildlife or infection with other nontuberculous mycobacteria). In this line of thought, other factors related to the practices of all stakeholders involved (private and government veterinarians, managers herd owners) should be addressed, evaluated and improved if necessary.

Conflict of Interest

None of the authors of this paper have a financial or personal relationship with other people or organization that could inappropriately influence or bias the content of the paper.

Acknowledgment

This study was funded by DST-SERB (Department of Science and Technology) New Delhi, and I am highly thanks to Indian Veterinary Research Institute (IVRI), Izatnagar, Bareilly, Uttar Pradesh, India for given research place for this work. I am highly thankful to late Dr. Deepak Sharma (Principal Scientist and Head of Department) for valuable advice and suggestion.

References

  1. Andersen AB and Brennan P.1994.Protein antigens of Mycobacterium tuberculosis. In: Bloom, B.R. (Ed.), Tuberculosis: Pathogenesis, Protection and Control. Amer. Soc. Micro. Washington DC: 307-332.
  2. Aranaz A, De Juan L, Montero N, Sanchez C, Galka M, Delso C, Alvarez J, Romero B, Bezos J, Vela AI, Briones V, Mateos A and Dominguez L. 2004. Bovine tuberculosis (Mycobacterium bovis) in wildlife in Spain. J. Clin. Microbiol.42: 2602–2608.
  3. Aranday-Cortes E, Bull NC, Villarreal-Ramos B, Gough J, Hicks D, Ortiz-Pelaez A, Vordermeier HM and Salguero FJ. 2012. Upregulation of IL-17A, CXCL9 and CXCL10 in early stage granulomas induced by Mycobacterium bovis in cattle. Transbound. Emerg. Dis.60 (6): 525-37.
  4. Broughan JM, Crawshaw TR, Downs SH, Brewer J and Clifton-Hadley RS. 2013.Mycobacterium bovis infections in domesticated non-bovine mammalian species. Part 2: A review of diagnostic methods. Vet. J. 19 : 346–351
  5. Cagiola M, Feliziani F, Severi G, Pasquali P and Rutili D. 2004.Analysis of possible factors affecting the specificity of the gamma interferon test in tuberculosis-free cattle herds. Clin. Diagn. Lab. Immunol.11: 952–956.
  6. Casal C, Diez-Guerrier A, Alvarez J, Rodriguez-Campos S, Mateos A, Linscott R, Martel E, Lawrence JC, Whelan C, Clarke J, O’Brien A, Dominguez L and Aranaz A. 2014.Strategic use of serology for the diagnosis of bovine tuberculosis after intradermal skin testing. Vet. Microbiol. 170: 342–351.
  7. Coetsier C, Vannuffel P, Blondeel N, Denef JF, Cocito C, Gala JL. 2000. Duplex PCR for Differential Identification of Mycobacterium Bovis, M. Avium and M. Avium Subsp. Paratuberculosis in Formalin- Fixed Paraffin-Embedded Tissues From Cattle. J. Clin. Microbiol. 38 (8): 3048-3054.
  8. De la Rua-Domenech R, Goodchild AT, Vordermeier HM and Hewin-son RG, Christiansen KH, Clifton HRS. 2006. Ante mortem diagnosis of tuberculosis in cattle: a review of the tuberculin tests, gamma interferon assay and other ancillary diagnostic techniques. Res. Vet. Sci. 81: 190–210.
  9. Francis J, Seiler RJ, Wilkie IW, O’ Boyle D, Lumsden MJ and Frost AJ. 1978. The sensitivity and specificity of various tuberculin tests using bovine PPD and other tuberculins. Vet. Record. 103: 420-435.
  10. Good M and Duignan A. 2011. Perspectives on the history of bovine TB and the role of tuberculin in bovine TB eradication. Vet. Med. Internat. 1-11.
  11. Gutaa S, Casal J, Garcia-Saenzb A, Saez JL, Pacios A, Garciaf P, Napp S and Allepuz A. 2014.Risk factors for bovine tuberculosis persistence in beef herds of Southern and Central Spain. Pre. Vet. Med. 115: 173–180.
  12. Hope JC, Thom ML, Villarreal-Ramos B, Vordermeier HM, Hewinson RG and Howard CJ. 2005. Vaccination of neonatal calves with Mycobacterium bovis BCG induces protection against intranasal challenge with virulent M. bovis. Clin. Exp. Immunol. 139: 48–56.
  13. Humblet MF, Walravens K, Salandre O, Boschiroli ML, Gilbert M, Berkvens D, Fauville-Dufaux M, Godfroid J, Dufey J, Raskin A, Vanholme L and Saegerman C. 2011. Monitoring of the intra-dermal tuberculosis skin test performed by Belgianfield practitioners. Res. Vet. Sci. 91: 199–207.
  14. Juan S, Sanes JM, Ramis G, Masa A, Quereda JJ, Villarreal-Ramos B, Villar D and Pallares FJ. 2014. Evaluation of the single cervical skin test and interferon gamma responses to detect M. bovis infected cattle in a herd co infected with M. avium subsp. Paratuberculosis. Vet. Microbiol. 171: 139–146.
  15. Kim JH, Chang YW, Bok E, Kim HJ, Lee H, Cho SN, Shin JS and Yoo KH. 2014. Detection of IFN-γ for latent tuberculosis diagnosis using an anodized aluminum oxide-based capacitive sensor. Biosen. Bioelectron. 51: 366–370.
  16. Krebs JR, Anderson RM, Clutton-Brock T, Donnelly CA, Frost S, Morrison WI, Woodroffe R and Young D. 1998. Badgers and bovine TB. Conflicts between conservation and health Sci. 279: 817–818.
  17. McGilla JL, Sacco RE, Baldwin CL, Telfer JC, Palmer MV and Waters WR. 2014. The role of gamma delta T cells in immunity to Mycobacterium bovis infection in cattle Francis. Vet. Immunol. Immunopathol. 159 : 133–143
  18. Mikkelsen H, Saxmose S, Gregers N and Potentiating J. 2009. Day-old blood samples for detection of interferon-gamma responses following infection with Mycobacterium aviumsubsp paratuberculosis. Proceedings of 10ICP.
  19. Monaghan ML, Doherty ML, Collins JD, Kazda JF and Quinn PJ. 1994. The tuberculin test. Vet. Microbiol. 40 (1–2): 111–124.
  20. OIE PR and Jones SL. 2001. BOVIGAM An in-vitro cellular diagnostic test for bovine tuberculosis. Tuber (Edinburgh, Scotland) 81: 147–155.
  21. Phillips CJC, Foster CRW, Morris, PA and Teverson R. 2003. The transmission of Mycobacterium bovis infection to cattle. Res. Vet. Sci. 74: 1‐15.
  22. Pollock JM, Welsh MD and McNair J. 2005. Immune responses in bovine tuberculosis: towards new strategies for the diagnosis and control of disease, Vet. Immunol. Immunopathol, 108, 37–43.
  23. Schoenborn JR and Wilson CB. 2007. Regulation of interferon-gamma during innate and adaptive immune responses. Adv. Immunol. 96: 41–101.
  24. Vordermeier HM, Chambers MA, Cockle PJ, Whelan AO, Simmons J and Hewinson RG. 2002. Correlation of ESAT-6-specific gamma interferon production with pathology in cattle following Mycobacterium bovis BCG vaccination against experimental bovine tuberculosis. Infect. Immune. 70: 3026–3032.
  25. Wood PR, Rothel JS, Mc Wathers, PGD and Jones SL. 1990. Production and characterization of monoclonal antibodies specific for bovine gamma-interferon. Vet. Immunol. Immunopathol. 25: 37–46.
  26. Xu Z, Shan F, Shan F, Meng C, Zhou X, Zhang X, Chen X, and Jiao X. 2014. Generation and application of a 293 cell line stably expressing bovine interferon-gamma. Pro. Exp. Puri. 99:131–137.
Full Text Read : 5029 Downloads : 1142
Previous Next

Open Access Policy

Close