NAAS Score 2019

                   5.36

Declaration Format

Please download DeclarationForm and submit along with manuscript.

UserOnline

Free counters!

Previous Next

Effect of Polymorphism in FGF2 Gene on First Lactation Milk Yield and Milk Composition Traits in Karan-Fries Cattle

Arun Pratap Singh A. K. Chakravarty Ashwani Arya Manvendra Singh M. A. Mir
Vol 9(3), 297-304
DOI- http://dx.doi.org/10.5455/ijlr.20190110073220

The present study was performed to investigate the polymorphisms in the Fibroblast Growth Factor 2 (FGF2) gene and to reveal the association of different genotypes corresponding to gene with breeding value (BV) for first lactation milk yield and milk composition traits of Karan fries (HF crossbred) cattle. The traits were adjusted against the significant effect of non-genetic factors. Blood samples were collected on vacutainer tubes supported with EDTA to prevent blood clotting and DNA samples were isolated and purified using standard phenol chloroform method. Polymerase chain reactions were performed using specific primers for gene under study. FGF2 gene PCR products were subjected to cut them with specific restriction enzyme: Csp6I. Polymerase Chain Reaction – Restriction Fragment Length Polymorphism (PCR-RFLP) analysis of FGF2 (intron 1) gene revealed three genotypes; GG (171bp), AG (207bp and 171bp,) and AA (207bp). Genotypic frequencies of GG, AG and AA were 0.31, 0.52 and 0.17 whereas the allelic frequencies for G and A allele were 0.57 and 0.43, respectively. Breeding value of GG genotype was highest for ATDMY(kg) and 305MY (kg) (11.21 ± 0.67 and 3172.01 ± 51.33 ) whereas, AA genotype had highest breeding value for ATDFP and LFY (4.39 ± 0.16 and 137.41 ± 5.76). In addition, no significant effect of polymorphism on any of the traits was found. GG genotype was associated with a higher breeding value for 305MY, suggesting its further research in a large population and consequently its use in gene assisted selection for the genetic improvement of milk production.


Keywords : FGF2 Gene Milk Production Traits Karan Fries Cattle PCR-RFLP

At present, the major challenge of genetic studies in livestock species is the identification and mapping of individual QTL (Quantitative Trait Loci) and quantitative trait genes that control production traits. A review of publications shows that many QTL have been mapped for traits of economic importance in dairy cattle (Khatkar et al., 2004; www.animalgenome.org). However, little progress has been made on the identification of major genes affecting milk production and health traits in dairy cattle. One major limitation when choosing a candidate gene is the large number of provisional genes present in most QTL regions. Fibroblast growth factor 2 (FGF2), located on distal chromosome 6, is expressed by the bovine endometrium throughout the estrous cycle and early pregnancy and regulates trophectoderm expression of IFNT(Interferon Tau), the maternal recognition factor of pregnancy in ruminants (Michael et al., 2006; Oco´n-Grove et al., 2008). Plath et al. (1998) reported the expression of FGF2 in the bovine mammary gland during the different developmental stages and suggested, based on the concentrations of mRNA and protein, that FGF2 might be important for the development and reorganization of the mammary gland. FGF2 was chosen for this study because of its role in the interferon-τ signal transduction pathway and was found to be associated with production traits (Oikonomou et al., 2011). Sequencing of a total of 6.4 kb including 3 exons of the gene revealed only one SNP (A/G) in intron 1 at position 11646 (Wang et al., 2008). FGF2 variants were associated with fat yield and percentage, somatic cell score, and productive life with significant dominance and complete dominance effects (Wang et al., 2008). The objective of this study was to examine the polymorphism in FGF2 gene and ascertain the association of FGF2 polymorphisms with milk production traits in Karan Fries cattle.

Materials and Methods

Location and Climatic Condition of the Study Area

The study area (Karnal) is situated at an altitude of 235 to 252 meters (748 feet) above the mean sea level at 29.68°N latitude and 76.980E longitude in eastern zone of Haryana which comes under the Trans-Gangetic plain agro climatic zone of India. The climate that prevails is subtropical in nature. The temperature in summer months (April to June) ranges between 24°C – 44°C. Karnal experiences moderate rainfall in the months of July and lasts till September. Winters are extremely cold. The temperature ranges from 4°C to 32°C in winter months (October, November, December and January).

Experimental Animals and Data Source

The data of first lactation production records of 1379 Karan-Fries cows sired by 102 bulls spread over a  period of 27 years  (1989-2016), was collected from Record Cell, Animal Genetics and Breeding Division of ICAR-National Dairy Research Institute, Karnal. Data were analyzed for first lactation traits viz. first lactation 305-day milk yield (FL305MY-kg), Average test day milk yield (ATDMY-kg), Average test day fat percentage (ATDFP-%), LFY – Lactation fat yield (kg). Sires having five or more progeny were evaluated on the basis of first lactation records. The study was classified into nine periods. Each year was sub-classified into four seasons, depending on prevalent meteorological factors, feed and fodder availability as recorded in CSSRI, Karnal (Singh, 1983). Age at first calving (AFC) of Karan-Fries cows was classified into three age groups using mean and one standard deviation after normalizing the distribution of AFC in the population. Blood (8-10 ml) samples were collected aseptically by jugular vein puncture using vacutainers containing EDTA as anticoagulant from randomly selected KF animals after obtaining permission from Institute Animal Ethics Committee. 189 animals for PCR-RFLP were used for assessing the effect of SNP markers on breeding values of KF (Karan-Fries) animals for milk yield and milk composition traits.

Standardization and Normalisation of Data                                             

The records of Karan-Fries cows of known pedigree and with normal lactation were included in the present study. The normal lactation was considered as a period of milk production by a cow for at least 100 days with a minimum of 500 kg and the cows calved and dried under normal physiological conditions. Out of 1679 Karan-Fries cows, information of 300 Karan-Fries cows were not considered for this study due to various reasons like history of abortion, still birth and other reproductive problems.

Isolation and Extraction of DNA from Blood

Genomic DNA was isolated by Phenol-chloroform method, as described by Sambrook and Russel (2001) with minor modifications. The quality and quantity of DNA was checked by agarose gel electrophoresis and UV spectrophotometer. The stock solutions were stored at -20°C and used for further analysis. The working solution was prepared by diluting the stock to 100 ng/µL for utilizing as DNA template in PCR.

Genotyping Procedure

For genotyping of SNP11646 (A/G) of the FGF2 gene (GenBank accession number NC_007304) a 207 bp fragment was amplified by PCR using the primer pair was as presented in Table 1 (Khatib et al., 2008b). PCR reaction was performed in a final volume of 25 μl containing 100 ng of template DNA, 10 pmole of each primer, 10X PCR buffer (20 mM Tris –HCl pH 8.4,50 mM KCl) 1mM MgCl2, 2.0 mM of dNTPs and 1 ul of Taq DNA polymerase (Amnion Biosciences Pvt Ltd , India). This solution was initially denatured at 94°C for 5 min, followed by 35 cycles of denaturation (94°C for 1 min), annealing (50°C for 1 min), elongation (72°C for 1 min) and a final extension at 72°C for 5 min. The amplified products were detected in 1.5% agarose gel electrophoresis. Aliquots of 5 μl of PCR products were applied to the gel. Constant Voltage of 100 V for 1 hour was used for products separation. After electrophoresis, the gel was stained with Ethidium bromide and images were obtained in UV tech gel document systems (Gel doc 1000, Bio-Rad, USA). Preliminary selection of the restriction enzymes to be used was done using NEBcutterV2.0 by submitting Bos taurus reference sequence of FGF2 (Accession No: ENSBTAG00000005691). The PCR products were digested with 5 U (Table 1) restriction enzymes (Fermentas, Germany), in 20 μL of reaction volume for 6 h at 37 ºC for the fragments containing the FGF2, then subjected to electrophoretic separation in 2.5% ethidium bromide-stained agarose gel.

Table 1: Primers and PCR-RFLP conditions used for the analysed polymorphisms

Amplified Targets Intron 1
Amplicon Size (bp) 207
Region Amplified 35211689-35211895
Primers (5′-3′) F- CATAGTTCTGTAGACTAGAAG
R- CCTCTAAAGAAGGATTAAGTCAAAATGGGGCTGGTA
Annealing Temp (Ta ºC) 50
Restriction Enzyme Csp6I
Digestion Product Size (bp) A:207
G:171
Restriction Sites 5’. GTAC .3’
3’. CATG .5’

Statistical Analysis

The effect of non-genetic factors on normalised production traits were studied by least-squares analysis for nonorthogonal data, using fixed linear model (Harvey, 1990). The following models were used with assumptions that different components being fitted into the model were independent and additive. The model considered for first lactation traits was as under-

Yijkl = μ + Pi + Sj + (AG)k + eijkl

Where,

Yijkl = observation on lth cow in kth age group of first calving, calved in jth season and ith period of calving; μ = overall mean

Pi = fixed effect of ith period of calving (1 to 9)

Sj = fixed effect of jth season of calving (1 to 4)

(AG)k = fixed effect of kth age group of animals at first calving (1 to 3) and

eijklm = random error ~ NID (0, σ2 e)

The difference of means between any two subclasses of period, season, and age group were tested for significance using Duncan’s Multiple Range Test (DMRT) as modified by Kramer (1957). The single trait animal model was considered for estimation of breeding values of KF animals for milk yield and milk composition traits using WOMBAT software (Meyer, 2007) as under-

Where,

kth observation of jth random effect of ith fixed effect

– Vector of observation of fixed effects (seasons, periods & age groups)

– Vector of additive genetic effect (Random animal effect)

– Design matrix/ Incidence matrix of fixed effect

– Design matrix/ Incidence matrix of random effect

– Vector of residual errors

Based on the available records pertaining to milk yield and its constituents on Karan-Fries cattle maintained at ICAR-National Dairy Research Institute, Karnal, an attempt was made to find the association of different genotypes of FGF2 gene with the milk yield traits and its composition. The effect of genotype on individual trait was explored using the, PROC GLM (SAS 4.3) with the help of the following model-

Yij = µ + Gi +eij

Where,

Yij – Breeding value of jth trait under effect ith genotype of SNP

m – Overall mean, Gi– Fixed effect of ith genotype of SNPs

eij – Random error ~ NID (0, σ2e)

Results and Discussion

Average, analysis of variance (ANOVA) of first lactation traits are presented in Tables 2 and 3.

Table 2: Mean, Standard error and Coefficients of variation of first lactation traits of Karan-Fries cattle

Trait N Mean± SE CV (%)
FL305MY (kg) 1379 3381.31± 37.29 31.16
ATDMY (kg) 1379 12.30± 0.13 23.21
ATDFP (%) 1379 5.07± 0.08 8.63
LFY (kg) 1379 140.54± 4.14 29.56

SE= Standard error; CV= Coefficient of variation; FL305MY=First lactation 305-days or less milk yield, ATDMY=Average test day milk yield, ATDFP=Average test day fat percentage, ATDFY=Average test day fat yield, LFY – Lactation fat yield (kg).

Table 3: Analysis of variance (M.S values) of first lactation milk yield and milk composition traits of Karan-Fries cattle

Sources of Variation FL305MY ATDMY ATDFP LFY
Period (8) 206770.70** 25.60** 0.52** 8092.15**
Season (3) 2273314.60* 25.09* 0.06 1494.16
Age group (2) 1851643.83 40.09 0.16** 1021.09
Residual (1363) 723648.36 7.12 0.03 1135.5

** P<0.01; * P<0.05

PCR-RFLP analysis of each PCR products was carried out using Csp6I, restriction enzyme reported by Khatib et al., 2008a for primer pairs for intron 1 of FGF2 gene for all 189 animals included in the study. The restriction fragments were resolved in 2.5-3.0% agarose gel and visualized in gel documentation system. Restriction fragment sizes and corresponding genotypes of FGF2 gene are given in Table 4.

 

Table 4: Restriction fragment sizes and corresponding genotypes of FGF2 gene in Karan Fries cattle

Gene-Restriction Enzyme Restriction Fragment Genotype
Combination Size (bp)
FGF2 Csp6I 207 AA
Intron 1 207, 171 AG
  171 GG

Genotyping was done according to the band patterns and for each allele and genotype, gene and genotypic frequencies were calculated. Csp6I RFLP for targeted region showed polymorphic pattern (Fig. 1) with three genotypes; GG (171bp), AG (207bp and 171bp) and AA (207bp).

Fig. 1: Csp6I PCR-RFLP patterns of FGF2 gene in Karan Fries cattle

Lane 5-6, 15-16: AA genotype (207 bp)

Lane 1-2, 4, 7-9, 11-12, 17-18: AG genotype (207 bp, 171 bp)

Lane 3, 13-14, 19: GG genotype (171 bp)

Lane 10: Product (207 bp)

Lane M: Marker (50 bp)

Genotypic frequencies of GG, AG and AA were 0.31, 0.52 and 0.17 whereas the allelic frequencies for G and A allele were 0.57 and 0.43, respectively (Table 5). Allelic and genotypic frequencies at the FGF2 locus estimated in the present study were similar to those reported by Khatib et al. (2008b) and Wang et al. (2008). Frequency of the G allele ranged from 0.53 to 0.65 in the latter two studies, while it was 0.57 in our study. Estimated allelic and genotypic frequencies in the present study are in concurrence with Oikonomou and co-workers 2011.

Table 5: Genotypic and allelic frequencies of FGF2 gene using PCR-RFLP in Karan-Fries cattle

Gene Region Frequency
Genotype Allele
Exon 14 GG AG AA G A
0.31(59) 0.52(98) 0.17(32) 0.57 0.43

Although Khatib et al. (2008a, b; 2009a, b) reported significant effects of the SNP in FGF2 loci on in vitro embryonic survival and fertilization rates, however, in the present study there was no significant association of these polymorphisms with the breeding values for first lactation milk yield and milk composition traits. This is in agreement with results presented by Wang et al. (2008), where no association between this polymorphism and milk yield was observed in three different Holstein populations. The higher breeding values for First lactation 305-day milk yield of the GG and AG genotypes than those of the AA genotype for milk performance are in agreement with Wang et al. (2008). However, no significant associations were found in our research, as shown in Table 6.

Table 6: Effect of polymorphism of FGF2 gene on breeding values for first lactation milk yield and milk composition traits in different genotypes

Genotype Traits
ATDMY ATDFP 305MY LFY
GG(59) 11.21 ± 0.67 4.32 ± 0.11 3172.01 ± 51.33 136.28 ± 2.48
AG(98) 9.90 ± 0.42 4.01 ± 0.07 3074.99 ± 73.27 130.14 ± 3.54
AA(32) 11.15 ± 1.07 4.39 ± 0.16 3064.53 ± 119.05 137.41 ± 5.76
P-value 0.26 0.114 0.837 0.33

 

Conclusion

Results of the present study suggest that the observed polymorphism had no effect on first lactation milk yield and milk composition traits. Therefore, any use of FGF2 polymorphism in selection schemes would probably have no adverse effect on these traits of great economic interest. In conclusion, results presented in this study suggest that the FGF2 polymorphism could be used in gene assisted selection for the genetic improvement of milk production. Further investigation of possible effects of the specific genes on milk production and composition traits, based on another independent and probably larger dataset, is needed before these are used for the genetic improvement of dairy cows.

Acknowledgments

The authors are thankful to Director ICAR-National Dairy Research Institute, Karnal and Director ICAR-National Bureau of Animal Genetic Resources, Karnal for providing necessary facilities.

References

  1. Harvey, W.R. (1990). Guide for LSMLMW, PC-1version, mixed model least squares and maximum likelihood computer programme, January 1990. Mimeograph Ohio State. University, USA.
  2. Khatib, H., Huang, W., Wang, X., Tran, A.H., Bindrim, A.B., Schutzkus, V., Monson, R.L. and Yandell, B.S. (2009a). Single gene and gene interaction effects on fertilization and embryonic survival rates in cattle. Journal of Dairy Science, 92, 2238–2247.
  3. Khatib, H., Maltecca, C., Monson, R.L., Schutzkus, V. and Rutledge, J.J. (2009b). Monoallelic maternal expression of STAT5A affects embryonic survival in cattle. BMC Genetics, 10, 13.
  4. Khatib, H., Maltecca, C., Monson, R.L., Schutzkus, V., Wang, X. and Rutledge, J.J. (2008b). The fibroblast growth factor 2 gene is associated with embryonic mortality in cattle. Journal of Animal Science, 86, 2063–2067.
  5. Khatib, H., Monson, R.L., Schutzkus, V., Kohl, D.M., Rosa, G.J. and Rutledge, J.J. (2008a). Mutations in the STAT5A gene are associated with embryonic survival and milk composition in cattle. Journal of Dairy Science, 91, 784–793.
  6. Khatkar, M.S., Thomson, P.C., Tammen, I. and Raadsma, H.W. (2004). Quantitative trait loci mapping in dairy cattle: review and meta-analysis. Genetics Selection Evolution, 36, 163–190.
  7. Kramer, C.V. (1957). Extension of multiple range tests to group croobred means. Biometrics, 13, 13-18.
  8. Meyer, K. (2007). WOMBAT- A tool for mixed model analyses in quantitative genetics by REML. J. Zhejiang Uni. Sci., 8, 815-821.
  9. Michael, D.D., Alvarex, I.M., Ocón, O.M., Powell, A.M., Talbot, N.C., Johnson, S.E., Ealy, A.D. (2006). Fibroblast growth factor-2 is expressed by the bovine uterus and stimulates interferon-tau production in bovine trophectoderm. Endocrinology, 147, 3571–3579.
  10. Oco´n-Grove, O.M., Cooke, F.N., Alvarez, I.M., Johnson, S.E., Ott, T.L. and Ealy, A.D. (2008). Ovine endometrial expression of fibroblast growth factor 2 (FGF2) and conceptus expression of FGF receptors during early pregnancy. Domestic Animal Endocrinology, 34, 135-145.
  11. Oikonomou, G., Michailidis, G., Kougioumtzis, A., Avdi, M. and Banos, G. (2011). Effect of polymorphisms at the STAT5A and FGF2 gene loci on reproduction, milk yield and lameness of Holstein cows. Research in Veterinary Science, doi:10.1016/j.rvsc.2011.01.009.
  12. Plath, A., Einspanier, R., Gabler, C., Peters, F., Sinowatz, F., Gospodarowicz, D. and Schams, D. (1998). Expression and localization of members of the fibroblast growth factor family in the bovine mammary gland. Journal of Dairy Science, 81, 2604-2613.
  13. Sambrook, J., Russell, W.D. (2001). Molecular cloning- a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY 1, 1.32-1.34 and 8.14.
  14. SAS Enterprise Guide 4.3. (2003). SAS Institute Incorporation Raleigh, North Carolina, U.S.A. Science, 25(2), 129-132.
  15. Singh, O.P. (1983). Climate of Karnal. Published by Central Soil Salinity Research Institute (ICAR), Karnal, India.
  16. Wang, X., Maltecca, C., Tal-Stein, R., Lipkin, E. and Khatib, H. (2008). Association of bovine fibroblast growth factor 2 (FGF2) gene with milk fat and productive life: an example of the ability of the candidate pathway strategy to identify quantitative trait genes. Journal of Dairy Science, 91, 2475–2480.
Abstract Read : 143 Downloads : 60
Previous Next
Close