Bone morphogenetic protein 15 (BMP15), also known as FecX is a member of the TGF-β superfamily. It expresses in oocytes and has potent role in prolificacy of sheep that affect the ovulation rate. The ovine BMP15 gene links to the X chromosome (FecX locus) and consists a coding 1179 nucleotide sequence in two exons, separated by a 5.4 kb intron, encoding a 393 amino acid residue precursor and a 125 amino acid mature peptide (Galloway et al., 2000). BMP15 regulates granulosa cell proliferation and differentiation by promoting granulosa cell mitosis, suppressing follicle-stimulating hormone receptor expression and stimulating kit ligand expression, all of which play a pivotal role in female fertility in mammals (Juengel et al., 2002; Moore et al., 2004; Chu et al., 2007). Five different BMP15 mutated alleles, called FecX alleles led to increased ovulation rates in heterozygous ewes and sterility in homozygous ewes (Hanrahan et al., 2004). In previous studies, heterozygous ewes with FecX^I (Inverdale), FecX^H (Hanna), FecX^B (Belclare), FecX^G (Galway) or FecX^L (Lacaune) mutations exhibited one to two additional ovulations compared with non-carriers, whereas homozygous ewes were sterile (McNatty et al., 2005). This finding indicates the critical impact of BMP15 or FecX on ovarian function in mammals (Bodin et al., 2007). Among them, FecX^G mutation is characterized by the C to T transition at nucleotide 718 position in exon 2 region. This introduces a premature stop codon in the place of glutamic acid at amino acid residue 239 (Q239Ter) of the unprocessed protein, which presumably resulted in complete loss of BMP15 function. The FecX^G mutation was associated with increased ovulation rate and sterility in Cambridge and Belclare sheep (Hanrahan et al., 2004).

SNP C>T has been reported in exon 2 of the BMP15 gene and associated with prolificacy in several exotic (Chu et al., 2007; Javanmard et al., 2011; Moradband et al., 2011 and Elkorshy et al., 2013) and few Indian sheep breeds (Kumar et al., 2008). However, scanty information is available on FecX^G polymorphism in Indian sheep breeds including Muzzafarnagari breed. Therefore, the present study was undertaken to investigate the status of FecX^G (C>T) polymorphism in exon 2 region of BMP15 gene in Indian Muzzafarnagari sheep breed.

Materials and Methods

Animals Source, DNA Extraction and HinfI/PCR-RFLP

A total of 200 adult females (2-5 years of age) of Muzzafarnagari sheep maintained at Livestock Farm Complex (LFC), DUVASU, Mathura (U.P.), were utilized in the present investigation. Genomic DNA was extracted from venous blood using the standard protocol of Sambrook and Russel (2001). The PCR cycle conditions and primers (F: 5′- CACTGTCTTCTTGTTACTGTATTTCAATGAGAC -3′ and ‘R: 5′- GATGCAATACTGCCTGCTTG -3′) were used for amplification of BMP15 exon 2 region as per method described by Moradband et al. (2011). The PCR-RFLP was carried out overnight at 37^oC with HinfI restriction enzyme in a total volume of 15μl containing 5.0 µl of PCR product, 1.5 µl of 10X RE buffer and 10 units (1.0 µl) of enzyme.

Statistical Analysis

The data was generated by estimating the frequency of different BMP15 genotypes. The allelic and genotypic frequencies were estimated by standard procedure (Falconer and Mackay, 1996).

Results and Discussion

The amplified fragments of the BMP15 exon 2 region revealed 141 bp product (Fig. 1). The results revealed that all the screened samples of Muzzafarnagari sheep were found monomorphic for FecX^G gene. The HinfI PCR-RFLP assay revealed only one type of banding pattern GG genotype, which was of 141 bp (uncut) in all the screened samples.

The genotypic frequencies of G+, ++ and GG genotypes were 0.0%, 0.0% and 100%, respectively in all the screened animals and the allelic frequency of allele + and G was observed as 0.0 and 1.0, respectively. These findings were similar to the report of Kasiriyan et al. (2011) in Sangsari sheep breed while were in contrast with the findings of Polley et al. (2010) and Kumar et al. (2015) in Garole. Dincel et al. (2018) in Chios and Pineda et al. (2018) in Colombian Creole sheep breeds wherein ++ (wild type) genotype was observed with fixed wild allele (+). However, the genotypic frequencies of ++, G+ and GG genotype as observed by Elkorshy et al. (2013) in Barki, Ossimi, and Rahmani sheep breeds, Chu et al. (2014) in Small Tailed Han sheep breed and Barakat et al. (2017) in Barki, Ossimi, and Rahmani sheep breeds were not in accordance with the findings of the present study as they have observed polymorphic pattern in these genotypes with varying degree of frequency of mutant allele G  (Table 1).

Table 1: Genotypic frequencies of BMP15 (FecX)/HinfI gene in different sheep breeds as observed by other authors

Conclusion

In the present study, we observed monomorphic pattern of FecX^G mutation in BMP15 gene in screened Muzzafarnagari breed, consequently we could not perform association study with reproduction trait because in these screened sheep FecX^G allele was found fixed. However, all the screened animals were fertile and 27% twinning rate was found in our Muzzafarnagari flock. These results may be due to small sample size and close organized herd from where the samples were taken for study making it imminent to further investigate this SNP along with other fecundity genes on large diversified population for better understanding of functioning of reproduction traits in sheep.

Acknowledgement

The assistance of Livestock Farm Complex (LFC), DUVASU Mathura (U.P.) for providing blood samples of Muzzafarnagari sheep and data is duly acknowledged. The authors also acknowledge the funding agencies (Department Animal Husbandry, Dairy and Fisheries; DADF, Government of India) for providing financial assistance under Muzzafarnagari conservation project during 2012-2018.

References

1. Asharani, A.D., Appannavar, M.M., Yathis, H.M., Hussain, M.S., Kasaralikar, R.V., Surunagi, M.D. (2018). Molecular variants of FecB and BMP15 fecundity genes in sheep (Ovis aries). International Journal of Livestock Research, 8(8), 185-195.
2. Bodin, L., Di Pasquale, E., Fabre, S., Bontoux, M., Monget, P., Ersani, L., Mulsant, P. (2007). A novel mutation in the bone morphogenetic protein15 gene causing defective protein secretion is associated with both increased ovulation rate and sterility in Lacaune sheep. Endocrinology, 148(1), 393–400.
3. Brakat, A.H.I., Salem, M.L., Daoud, M.N., Khalil, K.B.W., Mahrous, F.K. (2017). Genetic polymorphism of candidate genes for fecundity traits in Egyptian sheep breeds. Biomedical Research, 28(2), 851-857.
4. Chu, M.X., Jiao, C.L., He, Y.Q., Wang, J.Y., Liu, Z.H., Chen, G.H. (2007). Association between pcr-sscp of bone morphogenetic protein 15 gene and prolificacy in jining grey goats. Animal Biotechnology, 18(4), 263 – 274.
5. Dincel, D., Ardich, S., Samli, H., Balci, F. (2018). Genotype frequency of FecXB (Belclare) mutation of BMP15 gene in Chios (Sakiz) sheep. Uludag University Journal of the Faculty of Veterinary Medicine, 37(2), 87-91.
6. Elkorshy, N., Mahrous, K.F., Salem, L.M. (2013). Genetic polymorphism detection in four genes in Egyptian and Saudi sheep breeds. World Applied Sciences Journal, l27(1), 33-43.
7. Falconer, D.S. and Mackay, T.F.C. (1996). Genotypic frequencies. Introduction to quantitative Genetics (4^th Edition): pp.51-55.
8. Galloway, S.M., Mcnatty, K.P., Cambridge, L.M., Laitinen, M.P., Jennifer, J.L., Jokiranta, S., Mclaren, R.J., Luiro, K., Dodds, K.G., Montgomery, G.W., Beattie, A.E., Davis, G.H., Ritvos, O. (2000). Mutations in an oocyte-derived growth factor gene (BMP15) cause increased ovulation rate and infertility in a dosage-sensitive manner. Nature Genetics, 25(3), 279–283.
9. Hanrahan, P.J., Gregan, S.M., Mulsant, P., Mullen, M., Davis, G.H., Powell, R., Galloway, S.M. (2004). Mutations in the genes for oocyte-derived growth factors GDF9 and BMP15 are associated with both increased ovulation rate and sterility in Cambridge and Belclare sheep (Ovis Aries). Biology of Reproduction, 70 (4), 900–909.
10. Javanmard, A., Azadzadeh, N. and Esmailizadeh, K.A. (2011). Mutations in bone morphogenetic protein 15 and growth differentiation factor 9 genes are associated with increased litter size in fat-tailed sheep breeds. Veterinary Research Communication, 35, 157-167.
11. Juengel, J.L., Hudson, N.L., Heath, D.A., Smith, P., Reader, K.L., Lawrence, S.B., O’Connell, A.R., Laitinen, M.P., Granfield, M., Groome, N.P., Ritvos, O., McNatty, K.P. (2002). Growth differentiation factor 9 and bone morphogenetic protein 15 are essential for ovarian follicular development in sheep. Biology of Reproduction, 67, 1777-1789.
12. Kasiriyan, M.M., Hafezian, S.H., Hassani, N. (2011). Genetic polymorphism of BMP15 and GDF9 genes in Sangsari sheep of Iran. International Journalof Genetics and Molecular Biology, 3(1), 31-34.
13. Kumar, R., Taraphder, S., Sahoo, A.K., Das, P.K., Paul, R., Raja, D. (2015). Molecular characterization of Exon-2 of bone morphogenetic protein-15 (Bmp-15) gene in prolific Garole sheep using PCR-SSCP method. Indian Journal of AnimalHealth, 54(2), 115-122.
14. Kumar, S., Mishra, A.K., Kolte, A.P., Arora, A.L., Singh, D., Singh, V.K. (2008). Effects of the booroola (Fecb) genotypes on growth performance, ewe’s productivity efficiency and litter size in Garole × Malpura sheep. Animals in Reproduction Science, 105, 319-331.
15. McNatty, K.P., Juengel, J.L., Reader, K.L., Lun, S., Myllymaa, S., Lawrence, S.B., Western, A., Meerasahib, M.F., Mottershead, D.G., Groome, N.P., Ritvos, O., Laitinen, M.P. (2005). Bone morphogenetic protein 15 and growth differentiation factor 9 cooperate to regulate granulosa cell function in ruminants. Reproduction, 129 (4), 481-487.
16. Moore, R.K., Erickson, G.F., Shimasaki, S. (2004). Are BMP-15 and GDF-9 primary determinants of ovulation quota in mammals. Trends in Endocrinology and Metabolism, 15:8.
17. Moradband, F., Rahimi, G., Gholizadeh, M. (2011). Association of polymorphisms in fecundity genes of GDF9, BMP15 and BMP15-1B with litter size in Iranian Baluchi sheep. Journal of Animal Science, 24(9), 1179–1183.
18. Nadri, S., Zamani, P., Ahmadi, A. (2016). Novel mutation in exon 1 of the BMP15gene and its association with reproduction traits in sheep. Animal Biotechnology, 27(4), 256-261.
19. Pineda, R., Montes, D., Hernandez, D. (2018). Association of the Polymorphisms FecXR, FecGH, and FecGI and Non-Genetic Factors that Affect the Prolificacy of Colombian Creole Sheep. Indian Journal of Science and Technology, 11(17),1-7.
20. Polley, S., De, S., Brahma, B., Mukherjee, A., Vinesh, P., Batabyal, S., Arora, J.S., Pan, S.S., Kumar, A., Datta, K.T., Goswami, L.S. (2010). Polymorphism of BMPR1B, BMP15 and GDF9 fecundity genes in prolific Garole sheep. Tropical Animal Health and Production, 42, 985–993.
21. Sambrook, J. and Russel, D.W. (2001). Molecular cloning: A Laboratory Manual, 3rd Ed. Cold Spring Harbor Laboratory Press, New York, USA, 1: 6.1-6.