NAAS Score 2020

                   5.36

UserOnline

Free counters!

Previous Next

Genotypic Variations of Toll-Like Receptors 4 Gene and its Association with Intra-Mammary Infections in Rathi Cattles

Manoj Kumar Netra Gayanchand Gahlot Mohammad Ashraf Vijay Kumar Agrawal Govind Singh Dhakad
Vol 7(8), 274-280
DOI- http://dx.doi.org/10.5455/ijlr.20170619042728

Toll-like receptors (TLR) have been identified as crucial molecules for detection of invading pathogens and induction of host defence mechanism through recognition of pathogen-associated specific molecular patterns. Rathi cattle of Rajasthan is known for its disease resistance and milking potential. The present study was conducted to explore the genetic polymorphism in TLR4 gene by PCR-RFLP method and its association with mastitis in Rathi cattle. Blood samples (5 ml) were collected from 58 unrelated Rathi cattle (including 23 were suffered/suffering from mastitis) under aseptic conditions. Genomic DNA was isolated and TLR31 locus (343bp) of TLR4 gene was amplified by PCR using specific primers. HaeIII restriction enzyme was used for digestion and 343bp amplicons produced two different restriction patterns in the mastitic and control population. The first pattern was considered as ‘BB’ genotype having fragment sizes of 49 bp, 98 bp and 196 bp size. The other pattern was considered as ‘AB’ genotype having fragment sizes of 49 bp, 98 bp, 196 bp and 245 bp. The genotypic frequency of mastitic Rathi population was found to be 0.70 and 0.30 for ‘BB’ and ‘AB’ genotypes respectively, whereas the gene frequency of ‘A’ and ‘B’ allele in mastitic animals were found to be 0.15 and 0.85, respectively. Statistical analysis of association of TLR4 variants with mastitis by chi-square test did not revealed any significant difference (P≥0.05) between ‘AB’ and ‘BB’ genotypes in the mastitic.


Keywords : Rathi Cattle TLR-4 Gene RFLP

Introduction

Selenium (Se) and vitamin E play significant role in improving the immunity, antioxidant status, and reproduction in animals. Several reproductive problems like retained placenta, abortion, premature birth, cystic ovaries, metritis, and delayed conception were reported due to deficiency of vitamin E and Se (Surai, 2002). Selenium is required for the development and expression of non-specific humoral and cell mediated immune responses. Nicholson et al. (1991) observed improved weight gain and gain: feed ratio in dairy and beef calves fed 1mg Se kg-1 DM supplemented diet over control (0.26mg Se kg-1 DM) group. Studies conducted in our laboratory have shown significant improvement in growth performance due to Se supplemented diet in lambs (Kumar et al., 2009a) and improved immune status in buffalo calves (Mudgal et al., 2012). There are different sources of Se supplementation viz. inorganic (sodium selenite or sodium selenate) and organic sources (selenium yeast) used in animals feeds (Sethy et al., 2014 a, b; 2015). Generally, Se is supplemented in animal feeds as inorganic salts. However, studies have shown that organic Se is better absorbed and utilized as compared to inorganic Se (Guyot et al., 2007, Sethy et al., 2014 b). A diet deficient in vitamin E may increase Se requirement of the animal. Little work has been done to explore the effect of selenium yeast (organic selenium) and/or vitamin E supplementation on the performance of goats. Thus, the objective of the present study was to find out the effect of selenium yeast and/or vitamin E supplementation on growth, nutrient utilization and immunity in male kids.

Material and Methods

Animal’s Management and Feeding

Rathi is an important milch breed of cattle found in the arid regions of Rajasthan. It contributes 0.82% of indigenous cattle in India. In Rajasthan total Rathi cattle are 8, 59,890 in number in which total males are 1, 37,529 in number & total females are 7, 22,361 in number (Based on Breed Survey 2012, DADF, GOI). Mastitis is one of the most prevalent diseases of dairy cattle, which causes huge economic losses to the dairy industry worldwide (Ruegg, 2003). The incidence rate of clinical mastitis was 25%−60% (Ruegg, 2003) and is defined as an inflammatory reaction of the parenchyma of the mammary glands to bacterial, chemical, thermal or mechanical injury regardless of the cause and is characterized by a range of physical, chemical and usually bacteriological changes in the milk and pathological changes in the glandular tissue. Today, mastitis is considered to be a multifactorial disease, closely related to the production system and environment that the cows are kept in. TLR4 is a cell-surface receptor that recognizes a broad class of pathogen-associated molecular patterns, activates innate and adaptive immune responses, and plays an important role in pathogen defence. The identification of CD14, TLR-2, and TLR-4 on milk fat globule membranes suggests a direct role for the mammary gland parenchyma in pathogen detection. TLR-4 recognizes the conserved lipopoly-saccharide (LPS) pattern of Gram-negative bacteria and therefore, plays an important role in the innate immune status of cows during periods of risk from intramammary infection by Gram-negative organisms (Miller et al., 2005). It has been reported that the actual number of TLR-4 molecules involved in recognition is important for the initiation of signaling that leads to activation of the innate immune response (Triantafilou and Triantafilou, 2005). Though the disease is widely studied, very few reports exist indicating study at molecular aspects of mastitis, i.e., single nucleotide polymorphisms (SNP) in mastitis resistance gene and its correlation with inflammatory response is less documented. Ogorevc et al. (2009) developed an extensive database of candidate genes and genetic markers for mastitis related traits. Functional traits of the mammary gland have been studied using different approaches, including the QTL approach, association studies, and the candidate gene approach. Given the facts, the work was undertaken to study the genetic polymorphism in TLR 4 gene by PCR-restriction fragment length polymorphisms (RFLP) and its association with inta-mammary infections in Rathi cattle’s.

Ethical Approval

This experiment was conducted by Animal Genetics and Breeding department, College of Veterinary and Animal Science, Bikaner with all essential procedures of sample collection were performed strictly as specified by Institutional Ethical Committee with minimal stress to animals.

Sample Material

For present investigation blood samples were collected from the 58 unrelated animals of Rathi cattle (including 23 were suffered/suffering from mastitis) on the basis of health records maintained at Livestock Research Station, College of Veterinary and Animal Science, Rajasthan University of Veterinary and Animal Science, Bikaner andapproximately 5 ml of venous blood samples were collected in sterile vacutainer tubes containing 0.5 M EDTA as anticoagulant. The blood samples were gently mixed with EDTA and kept in ice pack to prevent cell lysis and stored at 4˚C until the isolation of genomic DNA.

DNA Extraction and PCR

Genomic DNA was extracted from the blood samples by phenol chloroform method and detected by 0.8% agarose gel electrophoresis. The primers, as described by Sentitula et al., 2012 for locus TLR31 of TLR4 gene were used to amplify an equivalent region in Rathi cattle and the 25 μL master mix was prepared for each sample by adding 14.2 µl of Nuclease Free Water, 5 µl of 5X PCR Taq buffer, 2.5 µl of MgCl2 (25mM),0.5 µl of dNTPs (10mM), 0.3 µl of each forward primer 5’CATTTTGGTTTCCTATTCAGCA3, reverse primer 5’GATCCAAGTGCTCCAGGTTG3’ and 0.2 µl of Taq DNA polymerase and the target DNA (2 µl) was separately added in the tube.

Polymorphism Detection

The polymorphism of T4 TLR31 was detected with PCR-RFLP. The 50 µl reaction mixture was prepared to adding 34 µl nuclease free water, 5 µl 10X Buffer and 10 µl PCR product were digests with 1 µl Hae III restriction enzyme and kept for digestion in incubator at 37˚C overnight. After the digestion, heat inactivation of the enzyme was done at 80˚C for 20 min. The restriction fragments were resolved by polyacrylamide gel electrophoresis on 8% gel in 1X TBE buffer at 120V for 1.5 hrs.

Traits and Statistical Analysis

The genotypes were detected by seeing the RFLP patterns of each sample in the PAGE gels. The frequency of T4 TLR31 genotypic patterns were estimated by standard procedure (Falconer and Mackey, 1998).

Genotyping Patterns Frequencies =

Gene Frequencies =

Where, D = number of animals homozygous for a particular allele, H = number of heterozygote animals and N = total number of animals

Analysis of Association between PCR-RFLP Genotypes Variants and Mastitis

Association between genotypes revealed by PCR-RFLP band patterns with incidence of mastitis was analysed using a chi-square (X2) test (Snedecor and Cochran, 1967).

Chi-square = Σ (O-E)2/E

Where, O = Observed frequencies and E = Expected frequencies

Assumption of Hypothesis

Null and alternative hypothesis were calculated the value of Hand HA. Null Hypothesis show the no significant difference between the genotypes/variants regarding mastitis incidence and the Alternative Hypothesis show the significant difference between the genotypes/variants regarding mastitis incidence.

Level of Significance

The validity of Ho against that of HA at 5% level of significance was tested. In standard statistical approach this is confidence level at which the hypothesis is rejected or accepted.

Inferences

Inferences were drawn as per standard approach of hypothesis that, if the calculated value (Ҳ2) > tabulated value hypothesis was rejected (null hypothesis) and accepted the alternative hypothesis, and concluded that there is significant difference between the genotypes/variants regarding mastitis incidence.

However, if calculated value (Ҳ2) < tabulated value hypothesis was accepted (null hypothesis) and rejected the alternative hypothesis, and concluded that there is no significant difference between the genotypes/variants regarding mastitis incidence.

Result and Discussion

All the samples (n=58) were amplified and produced amplicons of 343 bp (Fig.1).

Manoj1.jpg

The sizes of the amplified products were estimated through comparison with 100 bp ladder. Digestion of the 343 bp amplicons with HaeIII restriction enzyme produced two different restriction patterns (Fig. 2) in the mastitic population.

Manoj2.jpg

The first pattern was considered as ‘BB’ genotype having fragment sizes of 49 bp, 98 bp and 196 bp size. The other pattern was considered as ‘AB’ genotype having fragment sizes of 49 bp, 98 bp, 196 bp and 245 bp. The genotypic and gene frequency of mastitic Rathi population was found to be 0.70 and 0.30 for ‘BB’ and ‘AB’ genotypes respectively whereas the gene frequency of ‘A’ and ‘B’ allele in mastitic animals were found to be 0.15 and 0.85, respectively. The observed value of Chi-square was found to be 0.276 at 5% level of significance for the samples studied. Statistical analysis of association of TLR4 variants with mastitis did not revealed any significant difference (P≥0.05) between AB and BB genotypes. The results observed in the present study were in agreement with similar study conducted by Sentitula et al., 2012 in Sahiwal cattle and Murrah buffaloes. Their results showed that two alleles (‘A’ and ‘B’) with two genotypes ‘AB’ and ‘BB’ were found in the both population and there was no significant association of genotypes with occurrence of mastitis. A number of molecular typing methods like PCR-RFLP, PCR-SSCP and sequencing have been used to detect genetic diversity of TLR4 gene. PCR-RFLP, which identifies the variation in the DNA sequence Muggli-Cockett and Stone, (1998) offers an easy and cost effective method for studying TLR4 polymorphism. Several reports are available for TLR4 gene and mastitis, but some of them showed a positive correlation of TLR4 gene with Mastitis. Mesquita et al. (2012) studied Brazilian Holsteins for TLR4 polymorphism indicated that animals with combined genotypes AACCCC, GGTCGG, and GACCGC presented the lowest SCS and have the potential to be applied as molecular markers for assisted animal selection to improve milk quality. Carvajal et al. (2013) evaluated three SNPs contained in (TLR4) and lactoferrin genes of Chilean dairy cattle associated with mastitis traits: TLR4 P-226, TLR4 2021, and LF P-28. Results showed the TT genotype of TLR4 2021 was significantly associated with the healthy condition, but no associations with SCS were evident. Noori et al. (2013) showed the B allele of the SNP in T4CRBR2 of the TLR4 gene was associated with higher 305 day milk yield and breeding value for milk yield, and lower fat percentage and lower SCS, as compared with allele A. The B allele frequency was higher and the distribution of genotypes was not in Hardy-Weinberg equilibrium in the overall population. A study by Beecher et al. (2010) indicated an association of E3+2021 polymorphism in TLR4 gene with milk fat and protein percentage in late lactation in Holstein–Friesian, Jersey, Norwegian Red, Montbeliarde, and Holstein–Friesian × Jersey cows, but not in Holstein–Friesian bulls. Gulhane and Sangwan, (2012) observed significant (p≤0.05) difference in the genotypic frequencies of the two genotypes in healthy and mastitis Murrah buffaloes. The frequency of AA genotype was significantly higher (p≤0.05) in healthy animals and indicated the association of AA genotype with resistance to mastitis. Mitra et al. (2012) studied TLR-4 gene of Murrah buffaloes and was found highly.

References

  1. Beecher, C., Daly, M., Childs, S., Berry, D.P., Magee, D.A., McCarthy, T.V. and Giblin, L. (2010). Polymorphisms in bovine immune genes and their associations with somatic cell count and milk production in dairy cattle. BMC Genet, 11: 99.
  2. Breed Survey report (2013). Statistic Division, Department of Animal Husbandry, Dairying and Fisheries. Government of India.
  3. Carvajal, A.M., Huircan, P. and Lepori, A. (2013). Single nucleotide polymorphisms in immunity-related genes and their association with mastitis in Chilean dairy cattle. Genet. Mol. Res., 12(3): 2702-2711.
  4. Falconer, D.S. and Mackay, T.F.C. (1996). Introduction to Quantitative Genetics. 4th Edition. Longman Scientific and Technical, New York.
  5. Gulhane, A.B. and Sangwan, M.L. (2012). Polymorphism in TLR4 gene and its association with mastitis in Murrah buffaloes. IJBT, 11(3): 330-332.
  6. Mesquita, A.Q., Rezende, C.S.M., Mesquita, A.J., Garcia, E.A., Jardim, D.V. and Kipnis, A.P.J. (2012). Association of TLR4 Polymorphisms with subclinical mastitis in Brazilian Holsteins. Braz. J. Microbiol.,43(2): 692-697.
  7. Miller, S.I., Ernst, R.K. and Bader, M.W. (2005). LPS, TLR4 and infectious disease diversity. Nat. Rev. Microbiol., 3(1): 36-46.
  8. Mitra, M., Taraphder, S., Sonawane, G.S. and Verma, A. (2012). Nucleotide sequencing and SNP detection of toll-like receptor-4 gene in Murrah Buffalo (Bubalus bubalis). ISRN Mol. Biol., 2012: 7.
  9. Muggli-Cockett, N.E. and Stone, R.T. (1988). Identification of genetic variation in the bovine MHC DRB-Iike genes using sequenced bovine genomic probes. Anim. Genet., 19: 213-235.
  10. Noori, R., Mahdavi, A.H., Edriss, M.A., Rahmani, H.R., Talebi, M. and Soltani-Ghombavani, M. (2013). Association of polymorphism in Exon 3 of toll-like receptor 4 gene with somatic cell score and milk production traits in Holstein dairy cows of Iran. S. Afr. J. Anim. Sci., 43: 4.
  11. Ogorevc, J., Kunej, T., Razpet, A. and Dovc, P. (2009). Database of cattle candidate genes and genetic markers for milk production and mastitis. Anim. Genet., 40(6): 832-851.
  12. Ruegg P.L. (2003). Investigation of mastitis problems on farms. Vet Clin North Am: Food Anim Pract, 19 (1): 47-73.
  13. Sentitula, R.K. and Yadav B.R. (2012). Molecular analysis of TLR4 gene and its association with intra-mammary infections in Sahiwal cattle and Murrah buffaloes. Indian Journal of Biotechnology, 1: 267-273.
  14. Snedecor, G. W. and Cochran, W. G. (1967). Statistical Methods, 8th edition. The Iowa State University Press, Ames, Iowa, USA, 21-30.
  15. Triantafilou, M. and Triantafilou K. (2005). The dynamics of LPS recognition: complex orchestration of multiple recep-tors. J. Endotoxin. Res., 11(1): 5-11.
Full Text Read : 1693 Downloads : 320
Previous Next

Open Access Policy

Close