NAAS Score 2020

                   5.36

UserOnline

Free counters!

Previous Next

Investigation of Genetic Association of Single Nucleotide Polymorphisms in SP110 Gene with Occurrence of Paratuberculosis Disease in Cattle

Satish Kumar Subodh Kumar Ran Vir Singh Anuj Chauhan Swati Agrawal Amit Kumar Shoor Vir Singh
Vol 7(3), 81-88
DOI- http://dx.doi.org/10.5455/ijlr.20170223021951

The present study was conducted to find the association between SNPs in SP110 gene and occurrence of paratuberculosis in cattle. A total of 213 cattle were subjected to Johnin PPD, ELISA test (indigenous as well as Parachek kit method), faecal microscopy and faecal culture for detection of presence of bovine paratuberculosis infection. Based on the results of diagnostic tests, 51 animals each were assigned to case and control population. Two SNPs viz. rs110480812 and rs136859213 in SP110 gene were validated using PCR-RFLP with restriction enzymes CviKI-1 and HpyCH4III respectively. For SNP rs110480812, two genotypes i.e. CT and TT were observed with genotype frequencies in case as 15.69 and 84.31 while in control population as 5.88 and 94.12 respectively. The association study was carried out by PROC LOGISTIC procedure of SAS9.3. These genotypes were not significantly different (p>0.05) between case and control cattle. The ODDs of CT genotype verses TT genotype was 2.98 (0.74-11.94; 95 % CI). Neither alleles nor genotypes showed significant association with occurrence of paratuberculosis in the analyzed cattle population. Nevertheless, other SNPs in this gene must be analyzed in order to rule out the implication of SP110 gene in susceptibility to bovine paratuberculosis.


Keywords : SP110 gene Paratuberculosis Cattle SNP PCR-RFLP

Introduction

Bovine paratuberculosis, also known as Johne’s disease (JD), is a chronic, granulomatous inflammatory disease of the intestines of ruminants and some wild-type species. It is caused Mycobacterium avium spp. paratuberculosis (MAP). The disease is characterized by chronic diarrhoea and wasting that eventually may lead to death. Disease transmission occurs primarily via feed contaminated with faeces. Vertical transmission to progeny in utero or via colostrum and milk has also been reported (Nielsen et al., 2008; Whittington and Windsor, 2009). Economic losses to the cattle industry due to JD are associated with reduced production and reproduction; premature culling or animal death; and veterinary and management cost (Gonda et al., 2007; Lombard et al., 2005; Ott et al., 1999). Therapeutic, prophylactic and management strategies for JD are available, but they are difficult and expensive to implement. Therefore, improving host genetics through selective breeding to enhance herd resistance could be a potentially useful complementary strategy (Prajapati et al., 2017). In support of this strategy, estimates of the heritability for susceptibility to bovine JD have been found to range from 0.06 to 0.183 (Gonda et al., 2006; Koets et al., 2000; Mortensen et al., 2004). Candidate gene studies have primarily focused on innate immune molecules and identified important associations between various Johne’s disease phenotypes and genetic variants in interferon gamma (Pinedo et al., 2009b), interleukin 10 receptor alpha (Verschoor et al., 2010), nucleotide oligomerization domain 2 (Pinedo et al., 2009a; Ruiz-Larranaga et al., 2010a), peptidoglycan recognition protein 1 (Pant et al., 2011), solute carrier family 11 member 1 (Pinedo et al., 2009b; Ruiz-Larranaga et al., 2010c), SP110 nuclear body protein (Ruiz-Larranaga et al., 2010b), Toll-like receptor 1 (Mucha et al., 2009), Toll-like receptor (TLR) 2 (Koets et al., 2010, Chauhan et al., 2015, Sadana et al., 2015) and QTLs (Yadav et al., 2014). Overall, these studies suggest that susceptibility to MAP infection is at least partially determined by inherent genetic factors, and that breeding for increased resistance to JD may be possible. Investigating genes that encode proteins associated with innate immune system is likely to be useful in this regard, as these proteins provide immediate protection against a diverse variety of pathogens (Vasselon and Detmers, 2002).

The intracellular pathogen resistance 1 (Ipr1) gene is involved in triggering innate immune responses to multiple intracellular pathogens. In a murine model of Mycobacterium tuberculosis infection, IPR1 expression was upregulated in murine macrophages resistant to M. tuberculosis but was absent in susceptible ones; moreover, expression of an Ipr1 transgene construct in macrophages from susceptible animals resulted in the control of mycobacterial replication and eventually induced the death of infected cells (Pan et al., 2005). Thus, Ipr1 appears to play an important role in the control of M. tuberculosis within host macrophages and polymorphisms of its human ortholog, SP110 nuclear body protein, have been suggested to be associated with tuberculosis. Thus, the bovine SP110 gene was considered to be a promising candidate for a genetic association study of bovine paratuberculosis. The SP110 gene is a member of the SP100 family of nuclear body proteins located on BTA2 and encodes a leukocyte-specific nuclear body component. The protein can function as an activator of gene transcription and as a nuclear hormone receptor co activator. In addition, it has been suggested that the protein may play a role in ribosome biogenesis and in the induction of myeloid cell differentiation (Bloch et al., 2000). Three SNPs of the SP110 gene have been found to be associated with tuberculosis susceptibility in humans (Tosh et al., 2006). For these reasons, the bovine SP110 gene was selected as a promising candidate gene for MAP infection susceptibility in cattle. In this context, the aim of this study is to evaluate mycobacterial infection and its association with SNP mutation in SP110gene.

Material and Method

213 animals from 3 farms (IVRI Izatnagar, Rahura Dairy Kashipur and Agrawal milkey Bareilly) located in western Uttar Pradesh were screened to develop a case-control resource population. Out of 213 animals, 41 each of Sahiwal and Tharparkar, 32 were Holstein Friesian and rest 99 animals were crossbred. Each animal was screened by a panel of diagnostic tests viz. ELISA, Johnin intradermal test, faecal microscopy and faecal culture.

The single intradermal Johnin test for delayed type hypersensitivity reaction was carried out by the intra-dermal inoculation of 0.1 ml of Johnin PPD on the left side of the middle third of the neck. The skin thickness was measured with vernier calipers before and 72 hours after inoculation. Increase in skin thickness of over 4 mm was regarded as indicative for the presence of delayed-type hypersensitivity. ELISA for the detection of MAP infection was done by commercial ELISA kit (PARACHEK®, Prionics) and indigenous Elisa kit (Singh et al., 2008). The absorbance of each sample was recorded by ELISA reader and result was interpreted for infection status of animal. Ziehl–Neelsen stained smears of faeces were examined microscopically for presence of MAP. Slides displaying pink coloured short rods (0.5–1.5 μm), representable to MAP were considered as positive. Faecal culture examination was also performed in the experimental population as it is highly specific and gold standard test for MAP infection. Herrold’s Egg Yolk medium (HEY medium) was used for culturing of MAP and was prepared as per the method of Merkal et al. (1981) with some modifications. On the basis of these tests result, 51 animals which were negative in all the tests were designated as control population while 51 animals which were positive in at least two tests were designated as susceptible or case population. Two SNPs viz. rs110480812 and rs136859213 in SP110 gene was selected for the present study on the basis of previous report of association with MAP infection in cattle.

About 5 ml of venous blood was collected from the jugular vein of all case: control population animal into a sterile 15 ml polypropylene centrifuge tube containing EDTA (1.8 mg / ml of blood) under sterile condition. The samples were kept in –20 ºC till the isolation of DNA. Genomic DNA for all experimental cattle was isolated by Phenol: Chloroform extraction method as described by Sambrook and Russel (2001) with some modifications. The concentration and purity of DNA was determined by Nanodrop 1000 spectrophotometer. The DNA samples showed the OD260:OD280ratio between 1.7-1.9 were considered as good quality and used for further analysis.

SNP Selection and Genotyping

Two SNPs in SP110 gene (Ruiz-Larrañaga et al., 2010) viz. rs110480812 and rs136859213 assessable by PCR-RFLP were selected from NCBI database and suitable primers were designed using online software primer3. Primers were designed to amplify a 200-300 bp fragment which includes the targeted SNP rs110480812 F: 5’ TGGCACAGGATCTGAGGAAG3’ R: 5’GCCCATCATTTTTACCTGCTAC3’ and for rs136859213 F: 5’CAGTTGAAATTGTTTAGTTTTATGC3′ R: 5’CCTGTTTTGCCGACTGGTAT3’. Identification of a restriction enzyme allowing allele discrimination by in-silico analysis was done by the NEBcutter V2 program, which has an option for viewing fragments of an in-silico digest (Vincze et al., 2003). The primer details viz. annealing temperature, exact amplicon length, EMBL accession no. for each primer has been depicted in Table 1.

Table 1: Primer details viz. annealing temperature, amplicon length, NCBI accession no. and Primer sequence for each SNP

S. No. SNP ID NCBI Reference Sequence Primer Sequence(5’ to 3’) AT (°C) Amplicon size
1 rs110480812 NW_003103850.1 F: TGGCACAGGATCTGAGGAAG

R: GCCCATCATTTTTACCTGCTAC

56.3 187
2 rs136859213 NW_003103850.1 F: CAGTTGAAATTGTTTAGTTTTATGC

R: CCTGTTTTGCCGACTGGTAT

53.5 219

PCR-RFLP technique was used to genotype the SNPs in the product. PCR condition was standardized and fragments were amplified. Amplified PCR products of rs110480812 and rs136859213 were digested by specific REs CviKI-1 and HpyCH4III respectively. The RE digested PCR product was electrophoresed in 3.5 % w/v agarose gel for 2 h at 90 volt. 20 μl of digested product mixed with 4 μl of 6X loading dye were loaded into each well along with 50 bp DNA ladder in a separate lane. After completion of gel electrophoresis the digested product were visualized by UV transilluminator and documented to detect the genotype of each sample (Fig.1 and Fig. 2).

Fig 1

SP110

Statistical Analysis

Statistical analysis was performed using suitable logistic/categorical model using SAS 9.3 software. The univariable analysis was performed for categorical variables with a χ2 test on the distribution of allele and genotype frequencies between cases (paratuberculosis affected) and controls. Data were analyzed using PROC LOGISTIC procedure and ODDs ratios (ORs) with 95% CIs were calculated. The non-genetic factors like age (2 level), physical body condition score (2 level) and breed (2 level) were fitted and found that only physical body condition score (PBCS) was significantly associated with incidences of bovine paratuberculosis. The PROC ALLELE procedure of SAS 9.3 was used for testing of Hardy-Weinberg equilibrium (HWE), estimation of polymorphism information content (PIC), linkage disequilibrium and heterozygosity of SNPs markers used in present investigation.

Result and Discussion

The effect of nongenetic factors and single nucleotide polymorphism in SP110 gene on the occurrence of paratuberculosis disease were analysed by PROCLOGISTIC model of SAS 9.3 software.

Effect of Physical Body Condition Score

PBCS was significantly (p <0.01) different among case animals from control animals. The ODDs for animals with poor physical conditions 13.219 (4.146 – 42.146) at 95% CI were significantly different from healthy animals. It implies that poor physical conditions animals were at a higher risk of infection than animals with good physical conditions. However, Kumar (2014) found that PBCS failed to distinguish significantly (p>0.05) the affected animals from healthy animals.

Effect of Single Nucleotide Polymorphism

SNP rs136859213 showed monomorphic pattern in our test population having only AA genotype. Other SNP rs110480812 has displayed polymorphic pattern having only 2 genotypes in case: control population. The heterozygosity, PIC and allelic diversity were estimated for SNP rs110480812. Heterozygosity for the SNP was 10.78 % while PIC was 9.68% revealing a low polymorphism at this SNP. For SNP rs110480812, two genotypes i.e. CT and TT were observed with genotype frequencies as 10.78 and 89.22 % respectively showing the presence of two allele’s viz. C and T with gene frequency 5.39 and 94.61 % respectively. Two genotypes i.e. CT and TT were observed with genotype frequencies in case as 15.69and 84.31 while in control as 5.88 and 94.12 respectively. These genotypes were not significantly differing (p>0.05) in case as compared to control cattle. The ODDs of CT genotype verses TT genotype was 2.98 (0.74-11.94; 95 % CI). The gene frequencies of C and T were observed in case as 7.84 and 92.16 while in control population as 2.94 and 97.06 respectively. Gene frequencies were not significantly different (p>0.05) between case and control population. The ODDs of C allele verses T allele was 2.81 (0.72-10.9; 95 % CI) in case verses control population.

Because none of the SNP exhibited strong association with disease resistance, so our results are inconsistent with findings of several other workers, who investigated the role of SP110 gene not only in paratuberculosis (Vázquez et al., 2012; and Ruiz-Larranaga et al. 2010) but also in other related disease like tuberculosis (Tosh et al., 2006). The SNP c.587A>G was found to be significantly associated with MAP infection in cattle, with the major allele A appearing to confer greater disease susceptibility in one of the analyzed populations (Ruiz-Larrañaga et al., 2010). Possible reason for this conflict of results may either due to the small sample size in our analysed population or due to the use of different panel of diagnostic tests for case: control population. Previous workers (Vázquez et al., 2012; and Ruiz-larranaga et al., 2010) had used single or a couple of diagnostic test while in this study a panel of four diagnostic tests were used so they may have a biased case: control population. Thus in the present study neither alleles nor genotypes showed significant association with occurrence of paratuberculosis in the analyzed cattle population. Nevertheless, other SNPs in these genes must be analyzed in larger population in order to rule out the implication of SP110 gene in susceptibility to bovine paratuberculosis. The present results deepen our understanding of the genetic basis of susceptibility and resistance mechanisms related to paratuberculosis in cattle.

References

  1. Bloch, D.B., Nakajima, A., Gulick, T., Chiche, J.D., Orth, D., Suzanne, M. and Bloch, K.D. 2000. SP110 localizes to the PML-Sp100 nuclear body and may function as a nuclear hormone receptor transcriptional co activator. Molecular and cellular biology. 20(16): 6138-6146.
  2. Chauhan, A., Maurya, S., Shukla, S., Singh, R.V., Sonwane, A., Prakash, C., Maurya, R.V., Kumar, P., Sarvjeet, Baranwal, A., Sharma, D. and Bhushan, B. 2015. Analysis of Toll like Receptors and Interleukins Expression Profile in Mycobacterium avium sub sp. paratuberculosis Infected Cattle. Journal of Pure and Applied Microbiology. 9 (special edition): 297-305
  3. Gonda, M.G., Chang, Y.M., Shook G.E., Collins, M.T. and Kirkpatrick, B.W. 2006. Genetic variation of Mycobacterium avium spp. paratuberculosis infection in US Holsteins. Journal of Dairy Science. 89(5): 1804-1812.
  4. Gonda, M.G., Chang, Y.M., Shook G.E., Collins, M.T. and Kirkpatrick, B.W. 2007. Effect of Mycobacterium paratuberculosis infection on production, reproduction, and health traits in US Holsteins. Preventive veterinary medicine. 80(2): 103-119.
  5. Koets, A.P., Adugna, G., Janss, L.L.G., Van Weering, H.J., Kalis, C.H.J., Wentink, G.H., Rutten, V.P.M.G. and Schukken, Y.H. 2000. Genetic variation of susceptibility to Mycobacterium avium spp. paratuberculosis infection in dairy cattle. Journal of Dairy Science. 83(11): 2702-2708.
  6. Koets, A., Santema, W., Mertens, H., Oostenrijk, D., Keestra, M., Overdijk, M., Labouriau, R., Franken, P., Frijters, A., Nielen, M. and Rutten, V.P.M.G. 2010. Susceptibility to paratuberculosis infection in cattle is associated with single nucleotide polymorphisms in Toll-like receptor 2 which modulate immune responses against Mycobacterium avium spp. paratuberculosisPreventive veterinary medicine. 93(4): 305-315.
  7. Kumar, T. 2013. Study on single nucleotide polymorphism and its association with resistance/susceptibility to Mycobacterium avium spp. paratuberculosis infection in cattle. M.V. Sc .Thesis, Indian Veterinary Research Institute, Izatnagar, India. p.90.
  8. Lombard, J.E., Garry, F.B., McCluskey, B.J. and Wagner, B.A. 2005. Risk of removal and effects on milk production associated with paratuberculosis status in dairy cows. Journal of the American Veterinary Medical Association. 227(12): 1975-1981.
  9. Merkal, R.S, Miller, J.M, Hintz, A.M and Bryner, J.H. 1981. Intrauterine inoculation of Mycobacterium paratuberculosis into guinea pigs and cattle. American journal of veterinary research. 43:676-678.
  10. Mortensen, H., Nielsen, S.S. and Berg, P. 2004. Genetic variation and heritability of the antibody response to Mycobacterium avium spp. paratuberculosis in Danish Holstein cows. Journal of dairy science. 87(7): 2108-2113.
  11. Mucha, R., Bhide, M.R., Chakurkar, E.B., Novak, M. and Mikula, I. 2009. Toll-like receptors TLR1, TLR2 and TLR4 gene mutations and natural resistance to Mycobacterium avium spp. paratuberculosis infection in cattle. Veterinary immunology and immunopathology. 128(4): 381-388.
  12. Nielsen, S.S. and Toft, N., 2008. Ante mortem diagnosis of paratuberculosis: a review of accuracies of ELISA, interferon-γ assay and faecal culture techniques. Veterinary microbiology. 129(3): 217-235.
  13. Ott, S.L., Wells, S.J. and Wagner, B.A. 1999. Herd-level economic losses associated with Johne’s disease on US dairy operations. Preventive veterinary medicine. 40(3): 179-192.
  14. Pant, S.D., Verschoor, C.P., Schenkel, F.S., You, Q., Kelton, D.F. and Karrow, N.A. 2011. Bovine PGLYRP1 polymorphisms and their association with resistance to Mycobacterium avium spp. paratuberculosisAnimal genetics. 42(4): 354-360.
  15. Pan, H., Yan, B.S., Rojas, M., Shebzukhov, Y.V., Zhou, H., Kobzik, L., Higgins, D.E., Daly, M.J., Bloom, B.R. and Kramnik, I. 2005. Ipr1 gene mediates innate immunity to tuberculosis. Nature. 434: 767–772.
  16. Pinedo, P.J., Buergelt, C.D., Donovan, G.A., Melendez, P., Morel, L., Wu, R., Langaee, T.Y. and Rae, D.O. 2009a. Association between CARD15/NOD2 gene polymorphisms and paratuberculosis infection in cattle. Veterinary microbiology. 134(3): 346-352.
  17. Pinedo, P.J., Buergelt, C.D., Donovan, G.A., Melendez, P., Morel, L., Wu, R., Langaee, T.Y. and Rae, D.O. 2009b. Candidate gene polymorphisms (BoIFNG, TLR4, SLC11A1) as risk factors for paratuberculosis infection in cattle. Preventive veterinary medicine. 91(2): 189-196.
  18. Prajapati, B.M., Gupta, J.P., Pandey, D.P., Parmar, G.A. and Chaudhari, J.D. 2017. Molecular markers for resistance against infectious diseases of economic importance. Veterinary World. 10(1): 112-120.
  19. Ruiz Larrañaga, O., Garrido, J.M., Iriondo, M., Manzano, C., Molina, E., Koets, A.P., Rutten, V.P.M.G., Juste, R.A. and Estonba, A. 2010a. Genetic association between bovine NOD2 polymorphisms and infection by Mycobacterium avium spp. paratuberculosis in Holstein-Friesian cattle. Animal genetics. 41(6): 652-655.
  20. Ruiz-Larrañaga, O., Garrido, J.M., Iriondo, M., Manzano, C., Molina, E., Montes, I., Vazquez, P., Koets, A.P., Rutten, V.P.M.G., Juste, R.A. and Estonba, A. 2010b. SP110 as a novel susceptibility gene for Mycobacterium avium spp. paratuberculosis infection in cattle. Journal of dairy science. 93(12): 5950-5958.
  21. Ruiz-Larranaga, O., Garrido, J.M., Manzano, C., Iriondo, M., Molina, E., Gil, A., Koets, A.P., Rutten, V.P.M.G., Juste, R.A. and Estonba, A. 2010c. Identification of single nucleotide polymorphisms in the bovine solute carrier family 11 member 1 (SLC11A1) gene and their association with infection by Mycobacterium avium spp. paratuberculosisJournal of dairy science. 93(4): 1713-1721.
  22. Sadana, T., Singh, R.V., Singh, S.V., Saxena, V.K., Sharma, D., Singh, P.K., Kumar, N., Gupta, S., Chaubey, K.K., Jayaraman, S. and Tiwari, R. 2015. Single nucleotide polymorphism of SLC11A 1, CARD15, IFNG and TLR2 genes and their association with Mycobacterium avium spp. paratuberculosis infection in native Indian cattle population. Indian Journal of Biotechnology. 14(10): 469-475
  23. Sambrook, J. and Russel D.W. 2001. Molecular cloning- A laboratory manual. 3rd Ed.; Cold Spring Harbor laboratory Press, Cold Spring Harbor, New York.
  24. Singh, S.V., Singh, A.V., Singh, R., Sharma, S., Shukla, N., Misra, S., Singh, P.K., Sohal, J.S., Kumar, H., Patil, P.K. and Misra, P. 2008. Sero-prevalence of Bovine Johne’s disease in buffaloes and cattle population of North India using indigenous ELISA kit based on native Mycobacterium avium spp. paratuberculosis ‘Bison type’genotype of goat origin. Comparative Immunology, Microbiology and Infectious Diseases. 31(5): 419-433.
  25. Tosh, K., Campbell, S.J., Fielding, K., Sillah, J., Bah, B., Gustafson, P., Manneh, K., Lisse, I., Sirugo, G., Bennett, S. and Aaby, P., 2006. Variants in the SP110 gene are associated with genetic susceptibility to tuberculosis in West Africa. Proceedings of the National Academy of Sciences. 103(27): 10364-10368.
  26. Vasselon, T., Hanlon, W.A., Wright, S.D. and Detmers, P.A. 2002. Toll-like receptor 2 (TLR2) mediates activation of stress-activated MAP kinase p38. Journal of leukocyte biology. 71(3): 503-510.
  27. Vazquez, P., Ruíz-Larrañaga, O., Garrido, J. M., Iriondo, M., Manzano, C., Agirre,M., Estonba, A. and Juste, R. A. 2014. Genetic Association Analysis of Paratuberculosis Forms in Holstein-Friesian Cattle, Hindawi Publishing Corporation Veterinary Medicine International Volume 2014, Article ID 321327.
  28. Verschoor, C.P., Pant, S.D., You, Q., Schenkel, F.S., Kelton, D.F. and Karrow, N.A. 2010. Polymorphisms in the gene encoding bovine interleukin-10 receptor alpha are associated with Mycobacterium avium spp. Paratuberculosis infection status. BMC genetics. 11(1): 23.
  29. Vincze, T., Posfai, J. and Roberts, R.J. 2003. NEBcutter: A program to cleave DNA with restriction enzymes. Nucleic Acids Research. 31: 3688-3691.
  30. Whittington, R.J. and Windsor, P.A. 2009. In utero infection of cattle with Mycobacterium avium spp. paratuberculosis: a critical review and meta-analysis. The Veterinary Journal. 179(1): 60-69.
  31. Yadav, R., Sharma, A.K., Singh, R., Sonwane, A., Kumar, A., Chauhan, A., Kumar, S., Kumar, T., Renjith, R., Bhaladhare, A. and Prakash, O. 2014. An association study of SNPs with susceptibility to Bovine Paratuberculosis infection in cattle. The Indian Journal of Animal Sciences. 84 (5): 16–00.
Full Text Read : 1404 Downloads : 263
Previous Next

Open Access Policy

Close