NAAS Score 2019

                   5.36

Declaration Format

Please download DeclarationForm and submit along with manuscript.

UserOnline

Free counters!

Previous Next

Isolation, Antibiogram and Molecular Characterization of Enterotoxigenic Escherichia coli from Diarrheic Bovine Calves

Jayesh Patel Rafiyuddin Mathakiya and Bhargav Limbachiya
Vol 9(9), 188-197
DOI- http://dx.doi.org/10.5455/ijlr.20180818053826

A total of 117 fecal samples were collected from diarrheic calves from various regions of Gujarat. Out of total fecal samples screened, 89.74 % samples were found to be positive for E. coli by PCR assay using species specific phoA gene. Region wise prevalence of E. coli were found to be highest in Surat (100%). Age wise, E. coli infection was highly prevalent in age group-I (1-10 days) i.e. 41.88%. In vitro antibiotic resistant pattern showed high resistance against pefloxacin (68.57%), oxytetracycline (65.71%) and erythromycin (64.76%) while colistin resistance was observed in 10.47% isolates. All the isolates were screened for the presence of virulence associated genes by PCR assay. Out of 105 isolates, 29.52%, 26.66% and 7.61% isolates harboured STa, F5 and LT-1gene, respectively. Whereas, 11.42%, 3.80% 2.85%, 1.90% isolates possess genes in combination of F5 and STa, F5 and LT1, STa and LT1 and F5, STa and LT-1, respectively.


Keywords : Calf Scour ETEC Neonatal Calf Diarrhea PCR

Livestock is an essential part of the agricultural system in India and plays an important role in national economy as well as in socio-economic development of millions of rural livelihoods of India. Neonatal calf diarrhea is one of the most common diseases in young animals, causing huge economic and productive losses to bovine and dairy industry worldwide (Cho and Yoon, 2014). Disease is a multifactorial complex syndrome including infectious (Bacteria, Virus, Protozoa) as well as non-infectious factors related to the animal viz. immunological and nutritional status, the environment or the management as mentioned by Izzo et al. (2011). Neonatal calves are at the greatest risk of diarrhea in a first month of their life. Infectious diarrhea is the most significant cause of morbidity and mortality in neonatal dairy calves throughout the world and it can be caused by many pathogens including bacteria like E. coli and Salmonella as reported by Acha et al. (2004); viruses like Rotavirus and Coronavirus and some extent by Bovine viral diarrhea virus, Parvovirus, Astrovirus, Enterovirus by Izzo et al. (2011); and protozoa like Cryptosporidium parvum and  Eimeria spp. as reported by Izzo et al. (2011).

Escherichia coli (E. coli) is a gram negative, rod-shaped, motile, facultative anaerobic, non-spore forming member of Enterobacteriaceae family found in the gastrointestinal tract of warm-blooded animals and humans (Markey et al., 2013). Eosin methylene blue medium (EMB) is a selective medium for E. coli isolation. E. coli can be classified into six patho groups viz. Enterotoxigenic E. coli (ETEC), Enteropathogenic E. coli (EPEC), Entero invasive E. coli (EIEC), Enteroaggregative E. coli (EAEC), Enterohaemorrhagic E. coli (EHEC) and Shiga toxin producing E. coli (STEC) as mentioned by Quinn et al. (2011).

Among all above pathogroups, ETEC strain is mainly responsible for neonatal calf diarrhea in young animals via production of variety virulence factors. E. coli is transmitted by ingestion of contaminated feed, water, soil, faeces and direct contact from one person to another as mentioned by Ashraf et al. (2018). ETEC most commonly produce theF5adhesin antigen and the heat-stable (STa or STb) and/or heat-labile (LT-1 or LT-2) enterotoxins as described by Markey et al. (2013). STa and STb are only type of toxins usually produced by bovine and porcine ETEC, respectively. Pathogenic E. coli strains are responsible for pathogenicity by allowing them to colonize the host’s small intestinal mucosa through its unique colonization factors as well as producing STa and LT-1 enterotoxins. Thus, avoiding the immune response and stimulating the deleterious inflammatory response to produce diarrhea reported by Younis et al. (2009) and Croxen and Finlay (2010). The acute form of disease is characterized by progressive dehydration and death, sometimes in as few as 12 hrs. Considering to the role of ETEC in development of neonatal calf diarrhea, the present study was aimed to isolate E. coli from diarrheic calves culturally, confirming it is by PCR, develop the antibiogram and characterization of isolates for various virulence genes.

Materials and Methods

A total of 117 fecal samples were collected from calves of cattle and buffalo of 0-8 weeks of age. Samples were collected from farms of various region viz. Anand (n=31), Surat (n= 68) and Junagadh(n=18). The fecal samples were collected as per the method of Yilmaz (2016). The information such as age, sex and location of the calves were recorded. Diarrheal fecal samples of calves were inoculated on MacConkey agar (MA) and EMB for primarily identification of E. coli. Hemolytic activity of E. coli isolates was observed on 5% sheep blood agar as per Markey et al. (2013). The pure culture of E. coli isolates was stored in brain heart infusion (BHI) slants for further identification and other biochemical tests. The DNA was extracted by snap chill method. Briefly, the suspension of organisms was made in 100µl of Milli-Q water by picking up a typical colony in a 200µl PCR tube. The suspension was heated at 95°C for 15 minutes followed by sudden chill and all cell debris were removed by centrifugation at 10,000 rpm for 1 minute, and 3µl of the supernatant was used as a template DNA. The E. coli isolates also confirmed by PCR by using phoAprimer (Fig. 1). The isolates were subjected to in vitro antibiotic sensitivity testing as per the method of Bauer et al. (1966). Isolates were tested against commonly used antibiotics were obtained from HiMedia Laboratories Pvt. Ltd. (Mumbai, India).

All the E. coli isolates were characterized for viz. F5, STa and LT-1 genes using different sets of primers as given in Table 1. Steps and thermocycling condition of primer for above genes as per Table 2. Quantity and concentration of various components used for PCR were as per Table 3. The amplified PCR products were analysed by agarose gel electrophoresis on 2% agarose gel and visualized under UV light by a gel documentation system (Syngene, India).

Table 1: List of oligonucleotide primers used in PCR

Target Genes Name of Primers Sequences (5’-3’) Expected Reference
product
size (bp)
phoA phoA F CGATTCTGGAAATGGCAAAAG 720 Abdulgayeid et al. (2015)
phoA R CGTGATCAGCGGTGACTATGAC
F5 F5 F TATTATCTTAGGTGGTATGG 314 El-Seedy et al. (2016)
F5 R GGTATCCTTTAGCAGCAGTATTTC
STa ST F GCTAATGTTGGCAATTTTTATTTCTGTA 190 Pourtaghi et al. (2015)
ST R AGGATTACAACAAAGTTCACAGCAGTAA
LT-1 LT F AGCAGGTTTCCCACCGGATCACCA 132 Wani et al. (2013)
LT R GTGCTCAGATTCTGGGTCTC

Table 2: Steps and conditions of thermocycling for detection and characterization of E. coli isolates

Sr. No. Steps phoA gene F5 gene STa gene LT-1 gene
1 Initial denaturation Temperature 94oC 94oC 94oC 94oC
Time 5min 5min 5min 5min
2 Denaturation Temperature 94oC 94oC 94oC 94oC
Time 45sec 60sec 60sec 30sec
3 Annealing Temperature 56oC 55oC 55oC 56oC
Time 45sec 60sec 60sec 60sec
4 Extension Temperature 72oC 72oC 72oC 72oC
Time 60sec 90sec 90sec 90sec
5 Final Extension Temperature 72oC 72oC 72oC 72oC
Time 8min 10min 10min 8min
Cycles 30 35 35 30

 

 

Table 3: Quantity and concentration of various components of PCR reaction mixture

S. No. Components Volume Concentration
          1 2 X PCR Master Mix 12.50µl 2X
          2 Forward Primer 1.00µl 10pmole
(10pmol/µl)
          3 Reverse Primer 1.00µl 10pmole
(10pmol/µl)
          4 Template DNA 3.00µl
          5 Nuclease Free Water 7.50µl
Total 25.00µl

 

Results and Discussion

Overall Prevalence of E. coli

In the present study, out of total 117 samples screened, 89.74% (105/117) were found to be positive for E. coli by cultural characteristics and confirmed by PCR assay. Similar prevalence rate was reported El-Seedy et al. (2016) and Tarekegn and Molla (2017) whereas in contrast lower prevalence were reported by Gebregiorgis and Tessema (2016), Dawod et al. (2016) and Hakim et al. (2017). The difference in prevalence of E. coli in the above studies might be attributed to the variations in environmental and managemental conditions such as insufficient and/or poor-quality colostrum feeding/intake, gaps in management specifically calf handling practices including inadequate nutrition, exposure to severe environment, insufficient attention to the newborn calf, or a combination of these are often involved in scours outbreaks.

Region Wise Prevalence of E. coli

A total 105 isolates which includes 29 (93.54%) isolates from Anand, 68 (100%) from Surat and 8 (44.44%) from Junagadh. Difference in prevalence in various regions might be due to the difference in climatic conditions, sample size, management practices, personal hygiene, the age at which sample was collected and the farm size.

Age and Sex Wise Prevalence of E. coli

The isolation rates of E. coli decreased with increasing age of calves. The highest percentage of E. coli positive samples was detected in age group-I (1-10 days) i.e. 41.88% followed by 24.76% in age group-II (11-20 days), 20.95% in age group-III (21-30 days) and 8.57% in age group-IV (31-60 days), respectively. Villarroel (2009) reported that neonatal calves under 1 week of age are particularly more susceptible because the normal flora of the intestine is not fully established, have a naive immune system and also receptors for the adhesions of E. coli are present during the first week of life of the calves. Dawod et al., (2016); Gebregiorgis and Tessema (2016) reported that calves of age group-I (1-10 days) are most affected clinically might be due to an inadequate, poor quality of colostrum and delay in first colostrum feeding, which leads to failure of transfer of passive immunity is an important reason.

Cultural Isolation and Identification of E. coli Isolates

Based on cultural, morphological and staining characters, 105 isolates were identified as E. coli. Based on cultural characters like lactose fermenting colonies on MLA and preliminary identification by primary tests viz. 3% KOH, catalase and oxidase test, the isolates were identified as E. coli. Further, the isolates were confirmed as E. coli on EMB agar.

Overall Antibacterial Resistant Pattern of E. coli

The total 105 isolates obtained from diarrheal calves were subjected for In vitro sensitivity against 22 different antibiotics. The result of individual isolate to various drugs was interpreted as per manufacturer’s instructions (HiMedia Pvt. Ltd., Mumbai) and the results are presented in Table 4.

Table 4: Overall results of antibiotic susceptibility testing of E. coli isolates

Name of Antibiotic No. of isolates
(Code) Sensitive (%) Intermediate (%) Resistant (%)
Amikacin (AK, 30 mcg) 57 (54.29) 23 (21.90) 25 (23.81)
Amoxyclav (AMC, 30 mcg) 53 (50.48) 21 (20.00) 31 (29.52)
Ampicillin (AMP, 25 mcg) 26 (24.76) 15 (14.29) 64 (60.95)
Cefixime (CFM, 5 mcg) 51 (48.57) 24 (22.86) 30 (28.57)
Cefoparazone (CPZ, 75 mcg) 48 (45.71) 21 (20.00) 36 (34.29)
Cefotaxime (CTX, 30 mcg) 32 (30.48) 6 (5.71) 67 (63.81)
Ceftriaxone (CTR, 30 mcg) 60 (57.14) 16 (15.24) 29 (27.62)
Cephalothin (CEP, 30 mcg) 24 (22.86) 25 (23.81) 56 (53.33)
Chloramphenicol (C, 30 mcg) 100 (95.24) 0 (0.00) 5 (4.76)
Ciprofloxacin (CIP, 5 mcg) 58 (55.24) 25 (23.81) 22 (20.95)
Colistin (CL, 10 mcg) 94 (89.52) 0 (0.00) 11 (10.47)
Co-trimoxazole (COT, 25 mcg) 65 (61.90) 2 (1.90) 38 (36.19)
Enrofloxacin (EX, 10 mcg) 56 (53.33) 22 (20.95) 27 (25.71)
Erythromycin (E, 15 mcg) 0 (0) 37 (35.24) 68 (64.76)
­Gentamicin (GEN, 10 mcg) 84 (80.00) 11 (10.48) 10 (9.52)
Moxifloxacin (MO, 5 mcg) 39 (37.14) 0 (0.00) 66 (62.86)
Oxytetracycline (OTC, ­30 mcg) 15 (14.29) 21 (20.00) 69 (65.71)
Pefloxacin (PF, 5 mcg) 33 (31.43) 0 (0.00) 72 (68.57)
Spectinomycin (SPT, 100 mcg) 70 (66.67) 30 (28.57) 5 (4.76)
Streptomycin (S, 10 mcg) 31 (29.52) 30 (28.57) 44 (41.90)
Sulphadiazine (SZ, 300 mcg) 54 (51.43) 0 (0.00) 51 (48.57)
Tetracycline (TE, 30 mcg) 38 (36.19) 9 (8.57) 58 (55.24)

The findings in present study are in agreement with earlier studies by Wani et al. (2013), Hossain et al. (2014) and Dawod et al. (2016) reported high resistant against ampicillin 78%, 75.51% and 74%, respectively. In contrast to the present study, Abdulgayeid et al. (2015) and Abubaker et al. (2015) reported high resistant against oxytetracycline (91.57%) and erythromycin (84.70%), respectively.

Prevalence of drug resistant in E. coli against amikacin, amoxiclav, ampicillin, cefotaxime, colistin, erythromycin, gentamicin, moxifloxacin, oxytetracycline and sulphadiazine was variable in all the three regions as per Table 5.

Table 5: Region wise Antibacterial Resistant Pattern among E. coli Isolates

Name of Antibiotics (Code) Isolates of Region
Anand (%) Surat (%) Junagadh (%)
(29) (68) (8)
Amikacin (AK, 30 mcg) 3.45 32.35 25
Amoxyclav (AMC, 30 mcg) 31.03 32.35 0
Ampicillin (AMP, 25 mcg) 48.28 67.65 50
Cefixime (CFM, 5 mcg) 27.59 29.41 25
Cefoparazone (CPZ, 75 mcg) 34.48 33.82 37.5
Cefotaxime (CTX, 30 mcg) 58.62 64.71 75
Ceftriaxone (CTR, 30 mcg) 31.03 26.47 25
Cephalothin (CEP, 30 mcg) 48.28 54.41 62.5
Chloramphenicol (C, 30 mcg) 3.45 5.88 0
Ciprofloxacin (CIP, 5 mcg) 20.69 20.59 25
Colistin (CL, 10 mcg) 6.9 11.76 12.5
Co-trimoxazole (COT, 25 mcg) 41.38 33.82 37.5
Enrofloxacin (EX, 10 mcg) 31.03 23.53 25
Erythromycin (E, 15 mcg) 55.17 66.18 87.5
Gentamicin (GEN, 10 mcg) 13.79 5.88 25
Moxifloxacin (MO, 5 mcg) 65.52 58.82 87.5
Oxytetracycline (OTC, ­30 mcg) 79.31 63.24 37.5
Pefloxacin (PF, 5 mcg) 75.86 64.71 75
Spectinomycin (SPT, 100 mcg) 3.45 5.88 0
Streptomycin (S, 10 mcg) 31.03 47.06 37.5
Sulphadiazine (SZ, 30 mcg) 37.93 54.41 37.5
Tetracycline (TE, 30 mcg) 62.07 52.94 50

Whereas prevalence of drug resistant in E. coli to amikacin (3.45%), chloramphenicol (3.45%) and colistin (6.90%) of Anand region are very less as compared with other two regions might be due to the minimum used of these antibiotics and awareness of owner regarding antibiotic resistant. The E. coli isolates of Surat were highly resistant to ampicillin (67.65%), erythromycin (66.18%), cefotaxime and pefloxacin (64.71% each), oxytetracycline (63.24%), moxifloxacin (58.82%), cephalothin (54.41%) and tetracycline (52.94%).

Arya (2004) studied antibiogram pattern of E. coli isolated from diarrheic calves of the same region. She reported high resistance against amikacin (91.20%), enrofloxacin (84.61%), ampicillin (72.52%) and tetracycline (54.04%). In contrary to results of Arya (2004), the present study revealed that E. coli isolates were less resistant to amikacin (23.81%) and enrofloxacin (25.71%). This variation in resistant pattern might be due to less frequent use of these particular antibiotics during the past 15 years. Strikingly, the resistant against colistin was also recorded in isolates obtained from Junagadh (12.50%), Surat (11.76%) and Anand (6.90%) region. The colistin is used as a last resort of antibiotic for the treatment of Gram-negative bacterial infection and resistance towards colistin in present study speculate a future where there will not be any antibacterial in nearer future for the treatment of such infections in animals and humans.

In the present study, the highest rate of resistant has been recorded against antibiotic most commonly used either as feed additives or as curative agents in farm animals or for treatment in human medicine. This warrants restriction on the use of antibiotics as feed additives and rational use of antibiotic for infections in man and animals.

Molecular Characterization of E. coli Isolates Obtained from Diarrheic Calves for Virulence Factor

The PCR was performed for detection of F5, STa and LT-1gene of ETECusing specific primer pair, which yielded expected product size of 314bp, 190bp and 132bp, respectively as shown in Fig. 2, 3 and 4. The result of present study is in the agreement of Ok et al. (2009) as they detected 18.90% of F5 and Sta each in E. coli isolates. Wani et al. (2013) recorded Staand LT-1 at the rate of 17.39% and 73.91%, respectively. In contrary to present study, Arya (2004), Shams et al. (2012), Wani et al. (2013) detected lower prevalence of F5, Sta and LT-1 genes among the E. coli isolates. There were numbers of isolate possessed more than one virulence associated genes. Wani et al. (2013) and Abubaker et al. (2015) detected 2 and 5 isolates which carried genes for both Sta and LT-1, respectively.

In the present study, it was found that 12 (11.42%), 4 (3.80%), 3(2.85%) and 2 (1.90%) isolates possess F5 and STa, F5 and LT-1, Sta and LT-1and F5, Sta and LT-1 genes, respectively as per Table 6. Abubaker et al. (2015) detected 5 isolates possessing both Sta and LT-1. In contrast to present study, Shahrani et al. (2014) detected 100% presence of F5 and LT virulence associated genes and detected 8 (4.46%) isolates having all three genes F5, Sta and LT enterotoxin genes.

Table 6: Overall prevalence of virulence associated gene/s among E. coli isolates

Total No. of Isolates No. of Isolates Possess Virulence Associated Genes
F5 STa LT-1 F5+Sta F5+LT-1 STa+ LT-1 F5+STa+LT-1
105 28 (26.66%) 31 (29.52%) 08 (7.61%) 12 (11.42%) 4 (3.80%) 3 (2.85%) 2 (1.9%)

 

 

Conclusion

From the present study, it can be concluded that overall prevalence of E. coli is 89.74%. Prevalence of E. coli is higher in Surat (100%) and Anand (93.54%). The age wise, highest prevalence was recorded in 1-10 days age. The isolates were highly resistance to pefloxacin (68.57%), oxytetracycline (65.71%), erythromycin (64.76%), cefotaxime (63.81%) moxifloxacin (62.86%), ampicillin (60.95%), tetracycline (55.24%) and cephalothin (53.33%). Among all isolates, colistin resistance was observed in 10.47% isolates, which warrants the indiscriminate use of colistin. The highest prevalent virulence associated genes were Sta (29.52%) and F5 (26.66%).

Acknowledgments

The authors duly acknowledge the Dean, BVSc & AH, Anand Agriculture University for providing the support and facility for carrying out the research work.

Conflict of Interest

The authors declare no conflict of interest.

References

  1. Abdulgayeid, M., Shahin, H., Foad, S., & Ibrahim, S. M. (2015). Molecular Characterization of Escherichia coli isolated from buffalo calves in El-Behera governorate. Alexandria Journal of Veterinary Sciences, 47, 90-96.
  2. Abubaker, A., Ayis, E. I., Ali, A., Elgaddal, Y., &Almofti, A. (2015). Isolation, identification and enterotoxin detection of Escherichia coliisolated from calf diarrhea
  3. Acha, S. J., Kuhn, I., Jonsson, P., Mbazima, G., Katouli, M., & Mollby, R. (2004). Studies on calf diarrhoea in Mozambique: prevalence of bacterial pathogens. ActaVeterinariaScandinavica, 45(1), 27.
  4. Arya G. (2004). Isolation and identification of Escherichia coli from diarrhoeic calf faeces by biochemical tests, antibiogram pattern and PCR based detection of toxigenic genes. College of veterinary science and animal husbandry, Anand, Gujarat, India.
  5. Ashraf, I., Rashid, M., Javaid, M., & Bashir, M. (2018). Isolation and Characterization of Escherichia coli from Sheep, Goats and their Nomadic Handlers from Jammu Region of J & K. International Journal of Livestock Research, 8(3), 214-228.
  6. Bauer, A. W., Kirby, W. M., Sherris, J. C., & Turck, M. (1966). Antibiotic susceptibility testing by a standardized single disk method. American Journal of Clinical Pathology, 45(4), 493.
  7. Cho, Y. I., & Yoon, K. J. (2014). An overview of calf diarrhea-infectious etiology, diagnosis, and intervention. Journal of Veterinary Science, 15(1), 1-17.
  8. Croxen, M. A., & Finlay, B. B. (2010). Molecular mechanisms of Escherichia coli Nature Reviews Microbiology, 8(1), 26.
  9. Dawod, R. E., Mohammed, G. M. O., & Helal, I. M. (2016). Some bacteriological and molecular studies on Escherichia coli as causative agent of calves’ enteritis. Egyptian Journal of Chemistry and Environmental Health, 2(2), 195 -210.
  10. El-Seedy, F. R., Abed, A. H., Yanni, H. A., & El-Rahman, S. A. (2016). Prevalence of Salmonella and coli in neonatal diarrheic calves. Beni-Suef University Journal of Basic and Applied Sciences, 5(1), 45-51.
  11. Gebregiorgis, A., &Tessema, T. S. (2016). Characterization of Escherichia coli isolated from calf diarrhea in and around Kombolcha, South Wollo, Amhara Region, Ethiopia. Tropical Animal Health and Production, 48(2), 273-281.
  12. Hakim, A. S., Omara, S. T., Syame, S. M., & Fouad, E. A. (2017). Serotyping, antibiotic susceptibility, and virulence genes screening of Escherichia coli isolates obtained from diarrheic buffalo calves in Egyptian farms. Veterinary World, 10(7), 769.
  13. Hossain, M. K., Rahman, M., Nahar, A., Khair, A., &Alam, M. M. (2014). Isolation and identification of diarrheagenic Escherichia coli causing colibacillosis in calf in selective areas of Bangladesh. Bangladesh Journal of Veterinary Medicine, 11(2), 145-149.
  14. Izzo, M. M., Kirkland, P. D., Mohler, V. L., Perkins, N. R., Gunn, A. A., & House, J. K. (2011). Prevalence of major enteric pathogens in Australian dairy calves with diarrhoea. Australian Veterinary Journal, 89(5), 167-173.
  15. Markey, B., Leonard, F., Archambault, M., Cullinane, A., & Maguire, D. (2013). Clinical Veterinary Microbiology. 2nd Ed. UK, Elsevier Health. ISBN – 9780702055881.
  16. Ok, M., Guler, L., Turgut, K., Ok, U., Şen, I., Gündüz, I. K., Birdane, M. F., & Güzelbekteş, H. (2009). The studies on the aetiology of diarrhoea in neonatal calves and determination of virulence gene markers of Escherichia coli strains by multiplex PCR. Zoonoses and Public Health, 56(2), 94-101.
  17. Pourtaghi, H., Ghaznavi, S., Sodagari, H. R., &Ghadimianazar, A. (2015). Detection of Enterotoxigenic Escherichia coli Isolated from Calves’ Diarrhoea Samples by Molecular and Serological Methods. Advanced Studies in Biology, 7(6), 293-300.
  18. Quinn, P. J., Markey, B. K., Leonard, F. C., Hartigan, P., Fanning, S., &FitzPatrick, E. S. (2011). Veterinary Microbiology and Microbial disease. St Louis, United States: Mosby
  19. Shams, Z., Tahamtan, Y., Pourbakhsh, A., Hosseiny, M. H., Kargar, M., &Hayati, M. (2012). Detection of enterotoxigenic K99 (F5) and F41 from fecal sample of calves by molecular and serological methods. Comparative Clinical Pathology, 21(4), 475-478.
  20. Tarekegn, Y., &Molla, F. W. (2017). The prevalence of coli from diarrheic calves and their antibiotic sensitivity test in selected dairy farms of DebreZeit, Ethiopia. Advance in Biotechnology & Microbiology, 6(1), page number doi: 10.19080/AIBM.2017.06.555680.
  21. Villarroel, A. (2009). Scours in Beef Calves: Causes and treatments, (Retrieved on May,2013fromURLhttp://whatcom.wsu.edu/ag/documents/beef/ScoursBeefCalves_OSUem8977-e.pdf).
  22. Wani, S. A., Hussain, I., Beg, S. A., Rather, M. A., Kabli, Z. A., Mir, M. A., & Nishikawa, Y. (2013). Diarrhoeagenic Escherichia coli and Salmonella in calves and lambs in Kashmir: absence, prevalence and antibiogram. Revue scientifiqueet Technique (International Office of Epizootics), 32(3), 1-17.
  23. Yilmaz, V. (2016). Investigation of Rotavirus infection in calves with diarrhea in northeast Turkey. Animal and Veterinary Sciences, 4, 1, 1-4.
  24. Younis, E. E., Ahmed, A. M., El-Khodery, S. A., Osman, S. A., & El-Naker, Y. F. (2009). Molecular screening and risk factors of enterotoxigenic Escherichia coli and Salmonella in diarrheic neonatal calves in Egypt. Research in Veterinary Science, 87(3), 373-379.
Abstract Read : 45 Downloads : 17
Previous Next

Submit Case Reports for Special Issue (Dec’19)

Recommend IJLR to include in UGC-CARE list

Download Completed format here

IJLR_UGC CARE Recommendation

And

Recommendations of new journals should be routed by universities and colleges as follows:

  1. Universities: IQAC cell to respective regional CARE University
  2. Affiliated colleges: College IQAC cell to parent university’s IQAC cell. Parent university IQAC cell will forward to respective regional CARE University.

You can find Zonal UGC-CARE address here https://ugccare.unipune.ac.in/site/website/ugc-contact.aspx

Close