NAAS Score 2019

                   5.36

Declaration Format

Please download DeclarationForm and submit along with manuscript.

UserOnline

Free counters!

Previous Next

LEP/BsaAI Analysis of Leptin Gene and Its Association with Milk Production Traits of Lactating Hariana Cattle of India

Rambachan Rajesh Nigam Vijay Pandey Pawanjit Singh S. P. Singh Deepak Sharma Madhu Tiwari
Vol 9(6), 184-190
DOI- http://dx.doi.org/10.5455/ijlr.20190221092806

The study was aimed to investigate the genetic polymorphism in LEP gene and their associations with milk production traits in Hariana cows. The blood samples were collected from 62 Hariana cows and analyzed to identify LEP/BsaAI genotypes using PCR-RFLP method. Statistical analysis of LEP/BsaAI genotypes showed significantly longer lactation period in AA genotype than BB genotype in first lactation while total milk yield and milk yield in 300 days revealed higher yield in AA genotype than AB and BB genotypes in first lactation. Observations of this investigation advocated that genetic polymorphism in leptin significantly affects milk production in primiparous Hariana cows. However, further studies are required for detection of polymorphism at different region of leptin gene as well as in different populations of cattle to properly characterize the robustness of the associations of genetic polymorphisms with milk yield and other economically important traits across cattle populations.


Keywords : Hariana Cows Milk Production Traits Leptin Gene PCR-RFLP Polymorphism

Leptin is a cytokine synthesized primarily in adipose tissues (Forhead and Fowden, 2009) which has been reported to control body growth, energy homeostasis, feed intake, reproduction and immune function (Moravcikova et al., 2012; Pandey et al., 2016). Leptin acts in hypothalamus through neuropeptide -Y neuron receptor and plays a critical role in the regulation of feeding behaviour depending on the body energy status (Wayne et al., 1995). The LEP gene is situated on chromosome 4 containing three exons and two introns in cattle in which the coding region of 501 nucleotides is present in exon 2 and 3 (Liefers et al., 2002). Several mutations found in the bovine LEP gene reported to be associated with milk yield (Glantz et al., 2012), milk production (Pandey et al., 2017) and reproduction traits (Trakovicka et al., 2013, Rambachan et al., 2017) in different breeds of cattle. Thus, this study was aimed to elucidate the genetic polymorphism in LEP gene by PCR-RFLP assay and its association with milk production traits of indigenous Hariana cattle.

Materials and Methods

Sampling and DNA Extraction

Blood samples were collected from 62 Hariaya cows and DNA was extracted by phenol-chloroform method (Sambrook and Russell, 2001). Quality and quantity of DNA were determined by spectrophotometer method at 260 and 280 nm wavelengths.

PCR Amplification                                              

To analyze the status of leptin/ BsaAI locus polymorphism, the primer pair reported by Lien et al. (1997) (F: 5´GTCTGGAGGCAAAGGGCAGAGT3´ and R: 5´CCACCACCTCTGTGGAGTAG3´) was used to amplify the region corresponding to leptin gene intron 2 to exon 3 regions. About 100-150 ng DNA was amplified in a total volume of 25 μl PCR mix in thermocycler (Bio-Rad, USA). The PCR amplification cycling conditions for leptin involved initial denaturation at 94°C for 3 minutes, followed by 35 cycles at 94°C for 30 seconds, 58°C for 30 seconds and 72°C for 30 seconds with a final extension at 72°C for 5 minutes.

Restriction Reaction

Genotype analyses were carried out using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. For this, 5 μl of each PCR amplified product was digested using 5 U (0.5 μl) of restriction enzyme BsaAI (Ppu21I) (Fermentas) in a 15 μl total reaction and incubated in a water bath at 30°C for 15 hours. The digestion products were separated by horizontal electrophoresis in 2% agarose gel in 1X TBE buffer and stained with ethidium bromide (10 mg/µl) (Fermentas) prior to visualization under UV light.

Statistical Analysis

The allele and genotype frequencies of LEP/BsaAI polymorphism were estimated by standard procedure (Falconer and Mackay, 1996) and the deviation in the distribution of the genotype frequencies from Hardy-Weinberg equilibrium was estimated using chi square (χ2) test (P ≤ 0.05) (Snedecor and Cochran, 1989).

 

Association Study

The association study of different genotypes with the following milk production traits- lactation period (LP = date of drying –date of calving), total milk yield (TMY = calculated by totaling of daily milk records of individual cow after completion of their lactation.), average milk yield (AMY), milk yield in 300 days (MY300 = calculated by totaling of daily milk records of individual cows up to 300 days of lactation), peak yield (PY) and days to reach peak yield (DRPY) was performed. Statistical analysis of milk production traits in relation to different genotypes was carried out using the General Linear Model (GLM) using SPSS software. The following linear model was applied-

Yij = μ + Gi + eij

Where, Yij– observed trait value in animal; μ – mean trait value; Gi – effect of genotype; eij– random error.

The data were presented as Mean ± SEM. Significant differences among least square means of different genotypes were calculated using Duncan’s multiple-range test, and P values of 0.05 were considered statistically significant.

Results and Discussion

LEP/BsaAI assay revealed two types of alleles (A and B) and three genotypes viz. AA (522 bp), BB (441 and 81 bp) and heterozygous AB (522, 441, and 81 bp) genotypes (Fig. 2).

Fig. 1: Agarose (1%) gel electrophoresis showing PCR products of 522 bp; Lane M- DNA ladder (100 bp); Lane 1, 2, 3 & 4- PCR Products

AB genotype was the most frequent (54.8%) in all the screened samples, followed by the BB (35.5%) and AA (9.67%) genotypes. The frequencies of LEP/BsaAI A and B alleles were 0.37 and 0.63, respectively. The calculated χ2 test value was 5.99, indicating that selected population of Hariana cows was not in Hardy-Weinberg equilibrium. Association studies of LEP/BsaAI assay revealed significant influence of genotypes on lactation period (LP), total milk yield (TMY), milk yield in 300 days (MY300) and days to reach peak yield (DRPY) while peak yield (PY) did not show significant influence of genetic polymorphism in LEP gene in analyzed population of Hariana cattle.

Fig. 2: LEP/BsaAI PCR-RFLP assay showing genotypic pattern in 2% agarose gel: Lane 1- BB genotype (441 & 81 bp); Lane 2 & 5- AB genotype (522, 441 & 81 bp); Lane M- DNA ladder (100 bp); Lane 4- AA genotype (522 bp only)

The result showed significantly longer LP (P<0.05) in AA genotype than BB genotype in first lactation only while TMY and MY300 revealed higher yield in AA genotype than AB and BB genotypes in first lactation and other lactation did not show significant difference. DRPY showed significant effect of polymorphism in second lactation in which AA genotype was longer DRPY than AB and BB genotypes.

Table 1: Association of LEP/BsaAI genotypes with milk production traits of Hariana cattle

Lactation Genotype n LP (days) TMY (liters) MY300 (liters) PY (liters) DRPY (days)
I (N=49) AA 5 436.40 ± 46.69b 2800.00 ± 294.00b 2110.00 ± 210.00b 7.20 ± 0.43 35.60 ± 4.14
AB 27 364.70 ± 15.12ab 1570.00 ± 96.63a 1280.00 ±69.71b 6.18 ± 0.34 53.81 ± 4.74
BB 17 324.06 ± 28.34a 1250.00 ±102.00a 1080 ±64.69a 5.82 ±0.31 56.65 ± 8.41
II (N=35) AA 5 325.60 ±69.89 1720.00 ± 316.00 1500.00 ± 252.00 6.50 ±1.23 68.20 ±11.86b
AB 18 321.56 ± 27.56 1630.00 ±143.00 1430.00 ±108.00 7.91 ± 0.51 45.00 ±4.17a
BB 12 311.92 ± 27.51 1430.00 ± 170.00 1230.00 ± 120.00 5.83 ± 0.59 48.25 ± 3.88a
III (N=22) AA 3 316.67 ± 40.38 1940.00 ± 607.00 1690.00 ±456.00 9.50 ± 2.02 44.33 ±8.68
AB 12 283.92 ± 17.68 1400.00 ± 163.00 1370.00 ± 169.00 8.25 ± 0.75 42.58 ± 4.80
BB 7 221.57 ± 43.93 952.00 ± 226.00 864.00 ± 182.0 5.78 ± 1.02 50.43 ± 5.80

Means bearing a same superscript in a column differ non-significantly (P <0.05)

These results of genotypic and allelic frequencies of same study have already been documented in our earlier publication which showed that AB genotype was most frequent (54.80%) than AA (9.67%) and BB (35.50) genotypes (Rambachan et al., 2017). This is in accordance with the findings of other authors in various cattle breeds (Choudhary et al., 2005; Souza et al., 2010; Azari et al., 2012; Rezaei et al., 2015). The present study revealed 0.37 and 0.63 allelic frequency of A and B alleles, respectively, which simulated with findings of Choudhary et al. (2005) in Hariana and other breeds of cattle. Similar higher frequency of B allele than A allele was also reported by other authors in various cattle breeds (Azari et al., 2012; Rezaei et al., 2015), corroborated the findings of present study. The difference in allelic frequency can be elucidated as there may be some selection force favouring the G allele and acting against the A allele in these populations. However, Souza et al. (2010), Azari et al. (2012) and Rezaei et al. (2015) documented lesser frequency of LEP/BsaAI B allele in Nellore, Mazandarani and Iranian cattle, respectively.

The association study revealed that AA genotype is significantly associated with higher TMY, MY300 and higher LP in first lactation. In contrast, Rezaei et al. (2015) observed that AB genotype was significantly associated with higher milk yield, less fat and protein percentage, while AA genotype had higher fat and protein percentage than the other genotype. In the present finding, A allele is responsible for higher milk yield. So, it can be considered as a good indicator for milk production in the Hariana cattle breed. The finding of present study was consistent with the other reports of leptin genotypes and production traits. Similarly Pandey et al. (2017) revealed significant association of LEP/BsaAI genotypes with lactation period, total milk yield, milk yield in 300 days, peak yield and days to reach peak yield in Sahiwal cattle, corroborated the findings of present study. Moreover significant association of genetic polymorphism in different region of leptin gene on milk production traits was also reported by Sadeghi et al. (2008) at locus LEP/Kpn2I, Dandapat et al. (2009) at locus LEP/HphI in exon-2, Vohra et al. (2011) at locus LEP/Aci1, Clempson et al. (2011) at A59V locus in exon-3, Javanmard et al. (2010) and Moravcikova et al. (2012) at LEP/Sau3AI locus in intron-2 in different breeds of cattle. Sadeghi et al. (2008) reported that bulls of TT genotype of locus LEP/Kpn2I had higher milk, fat and protein yield compared with TC and CC bulls (P<0.05) while Dandapat et al. (2009) showed a highly significant association of LEP/HphI genotypes with the growth traits, first lactation milk yield, second lactation milk yield, average daily milk yield during first lactation and days in milk in first lactation in crossbred cattle. In addition, Vohra et al. (2011) revealed significantly higher 305 days milk yield in Karan Fries cattle with TT genotype as compared to cattle with CC genotype and Moravcikova et al. (2012) reported higher milk yield in animals with AA genotype as compared to other genotypes. Clempson et al. (2011) found significant association of leptin SNP A59V with the milk production traits which showed significant associations with both milk per day (lactation 1) and 305-d milk yield (lactation 2). Compared with the heterozygote, the TT substitution of A59V had significantly low milk yield in lactation 1 and also had a low 305-d milk yield in lactation 2. However, Kadlecova et al. (2014) at locus LEP/DraI and Ngu et al. (2015) at locus LEP/Kpn2I and LEP/Sau3AI, did not reveal association on milk production traits.

Conclusion

In conclusion, a leptin gene fragment of 522 bp was found polymorphic in Harian cow using restriction enzyme BsaAI. Leptin genotypes observed to have significant effect on lactation period, total milk yield, milk yield in 300 days and days to reach peak yield (DRPY) during first lactation. The homozygous cows (AA) tended to have significantly higher LP (P<0.05) in AA genotype than BB genotype in first lactation only while TMY and MY300 revealed higher yield in AA genotype than AB and BB genotypes in first lactation.

Although this study reveals the effect of genetic polymorphism of LEP/BsaAI genotype on milk production traits in Hariana cattle, however further studies are required for detection of genetic polymorphism at different region of leptin gene as well as in different populations of cattle to properly characterize the robustness of the associations of genetic polymorphisms with milk yield and other economically important traits across cattle populations. This preliminary investigation advocates that the leptin genotypes may play an important role in regulating milk production traits in Hariana cattle.

References

  1. Azari, M. A., Hasani, S., Heidari, M. and Yousefi, S. 2012. Genetic polymorphism of leptin gene using PCR-RFLP method in three different populations. Slovak Journal of Animal Science. 45(2): 39-42.
  2. Choudhary V, Kumar P, Bhattacharya TK, Bhushan B. and Sharma, A. 2005. DNA polymorphism of leptin gene in Bos indicus and Bos taurus Genetics and Molecular Biology. 28 (4): 23-27.
  3. Clempson, AM, Pollott GE, Brickell JS, Bourne NE, Munce N and Wathes DC. 2011. Evidence that leptin genotype is associated with fertility, growth, and milk production in Holstein cows. Journal of Dairy Science. 94: 3618–3628.
  4. Dandapat, A., Kumar, D., Ghosh, A. K. and Banerjee, D. 2009. Association of leptin gene polymorphism with growth, milk production and reproduction traits in Sahiwal and crossbred cattle. Indian Journal of Animal Science. 79 (9): 892-896.
  5. Falconer DS and Mackay TFC. 1996. Introduction to Quantitative Genetics 4th edn, pp: 56. Addison Wesley Longman Limited, England.
  6. Forhead AJ and Fowden AL. 2009. The hungry fetus? Role of leptin as a nutritional signal before birth. Journal of Physiology. 587: 1145-1152.
  7. Glantz M, Mansson HL, Stalhammar H. and Paulsson M. 2012. Effect of polymorphism in the leptin, leptin receptor and acyl-CoA: Diacylglycerol acyltransferase 1 (DGAT1) genes and genetic polymorphism of milk pro¬teins on bovine milk composition. Journal of Dairy Research. 79: 110-118.
  8. Javanmard, A., Khaledi, K., Asadzadeh, N. and Solimanifarjam, A. R. 2010. Detection of polymorphisms in the bovine leptin (LEP) gene: association of single nucleotide polymorphism with breeding value of milk traits in Iranian Holstein cattle. Journal of Molecular Genetics. 2: 10-14.
  9. Kadlecova, V., Nemeckova, D., Jecminkova, K. and Stadnik, L. 2014. Association of bovine DGAT1 and leptin genes polymorphism with milk production traits and energy balance indicators in primiparous Holstein cows. Mljekarstvo. 64 (1): 19-26.
  10. Liefers SC, Pas MFW, Veerkamp RF. and Van der Lende T. 2002. Associations between leptin gene polymorphisms and production live weight energy balance, feed intake and fertility in Holstein heifers. Journal of Dairy Science. 85: 227-238.
  11. Lien S, Undvold H, Lungland H. and Vage DI. 1997. Two novel polymorphisms in the bovine obesity gene (OBS). Animal Genetics. 28: 45-48.
  12. Moravcikova N, Trakovicka, A. and Kasarda, R. 2012. Polymorphism within the intron region of the bovine leptin gene in Slovak Pinzgau cattle. Animal Science and Biotechnology. 245 (1): 112-115.
  13. Ngu NT, Quynh LTB, Hon NV, Nhan NTH, Khoa DVA, Hung LT. and Xuan NH. 2015. Influence of leptin genotypes on milk fat and protein content of cross bred Holstein Friesian x laisind cows. Journal of Animal and Plant Science. 25 (1): 304-308.
  14. Pandey V, Nigam R, Rambachan, Singh P, Singh, S. P. and Madan, A. K. 2016. Plasma leptin and biochemical profile around parturition in primiparous Sahiwal cows. Ruminant Science. 5 (2): 227-233.
  15. Pandey V, Nigam R, Singh SP, Sharma D, Tiwari M. and Rambachan. 2017. Effect of leptin gene polymorphism on reproduction and production traits in Sahiwal cattle. Ruminant Science. 6 (2): 237-242.
  16. Rambachan, Nigam R, Pandey V, Singh P, Singh SP. and Sharma D. 2017. Genetic polymorphisms of leptin gene in relation with reproduction traits in Hariana cows. Journal of Animal Research. 7 (3): 1-5.
  17. Rezaei M, Mirhosseini SZ. and Hossein-Zadeh NG. 2015. PCR-RFLP analysis of leptin gene and its association with milk traits in native cattle of Iran (Bos indicus). Revista Mexicana de Ciencias Pecuarias, 6 (1): 15-24.
  18. Sadeghi M, Babak MMS, Rahimi G. and Javaremi, A.N. 2008. Effect of leptin gene polymorphism on the breeding value of milk production traits in Iranian Holstein. Animal, 2 (7): 999-1002.
  19. Sambrook J. and Russel DW. 2001. Molecular Cloning: A Laboratory Manual. 3rd edn, Vol. 1, Cold Spring Harbor Laboratory Press, New York, USA.
  20. Snedecor GW and Cochran WG. 1989. Statistical Methods. 8th edn, Ames: Iowa State Press, USA.
  21. Souza FR, Mercadante ME, Fonseca LF, Ferreira LM, Regatieri IC, Ayres DR, Tonhati H, Silva SL, Razook AG. and Albuquerque LG. 2010. Assessment of DGAT1 and LEP gene polymorphisms in three Nelore (Bos indicus) lines selected for growth and their relationship with growth and carcass traits. Journal of Animal Science. 88: 435-441.
  22. Trakovicka A, Moravcikova N. and Kasarda R. 2013. Genetic polymorphisms of leptin and leptin receptor genes in relation with production and reproduction traits in cattle. Acta Biochimica Polonica. 60 (4): 783-787.
  23. Vohra V, Chakravarty AK, Singh A, Gupta ID, Chopra A, Dubey PP. and Kumar D. 2011. Association of leptin gene polymorphism with 305 days milk. Indian Journal of Animal Science. 81 (4): 59-69.
  24. Wayne J, Kuenzel W. J. and Fraley, G. S. 1995. Neuropeptide: It´s in the neural regulation of reproductive function and feed intake in mammalian species. Poultry and Avian Biology Reviews. 6: 185-209.
Abstract Read : 179 Downloads : 38
Previous Next

Submit Case Reports for Special Issue (Dec’19)

Recommend IJLR to include in UGC-CARE list

Download Completed format here

IJLR_UGC CARE Recommendation

And

Recommendations of new journals should be routed by universities and colleges as follows:

  1. Universities: IQAC cell to respective regional CARE University
  2. Affiliated colleges: College IQAC cell to parent university’s IQAC cell. Parent university IQAC cell will forward to respective regional CARE University.

You can find Zonal UGC-CARE address here https://ugccare.unipune.ac.in/site/website/ugc-contact.aspx

Close