NAAS Score 2018

                   5.36

Declaration Format

Please download DeclarationForm and submit along with manuscript.

UserOnline

Free counters!

Previous Next

Molecular Diagnosis of Babesia gibsoni Infection

B. Subhash Chandra K. Rajkumar J. Thanislass P. Vijayalakshmi A. Abiramy Prabavathy
Vol 8(9), 98-103
DOI- http://dx.doi.org/10.5455/ijlr.20180214070823

In the present investigation, sixty-eight blood samples collected from the dogs suspected for Babesia gibsoni infection were subjected for examination of sensitivity of PCR in diagnosis of the disease. The present study was carried out at Rajiv Gandhi Institute of Veterinary Education and Research, Puducherry. Dogs presented to the Small Animal Unit, Teaching Veterinary Clinical Campus were taken for the study. Dogs suspected for Babesia gibsoni infection were subjected for diagnosis using Giemsa stained blood smear examination and Polymerase Chain Reaction. Samples turned out positive were custom sequenced and analyzed. More number of samples were found to be positive for babesiosis by Polymerase chain reaction. Isolate identified was found to be Babesia gibsoni (Asian Genotype). Polymerase chain reaction was superior to blood smear examination in diagnosing babesiosis and the incidence of disease was significantly higher in young age group.


Keywords : Asian Genotype Babesia gibsoni BLAST Dogs Diagnosis PCR

Canine babesiosis was considered as a very common and clinically significant disease among various vector borne diseases in dogs. B. gibsoni was found to be more prevalent when compared to B. canis, in Asiatic countries with size of 1.0–2.5 μm (Solano-Gallego and Baneth, 2011). The organism appears as oval or signet ring form inside the erythrocyte (Beugnet and Moreau, 2015). Young dogs of age less than 3 months were reported to be more frequently affected by babesiosis (Selvaraj et al., 2010; Selvi et al., 2011) and also most of the haemoprotozoal infections (75%) were reported to be occurred below the age of one year (Samradhni et al., 2005). Birkenheuer et al. (2005) reported that B. gibsoni has been identified to occur in various breeds of dogs, whereas Ayoob et al (2010) opined that B. gibsoni is commonly found in American Staffordshire and American Pit Bull Terrier (APBT) breeds. Diagnosis of the disease includes identification of the parasites in stained blood smears or infected tissue like lymph nodes or spleen where paired or unpaired piroplasms could be existing. Even though direct microscopic examination of a stained blood smear was the conclusive, feasible, common and cost-effective method to diagnose Babesia species (Amritpal et al., 2014) molecular diagnosis was considered to have higher sensitivity to detect Babesia protozoa from peripheral blood (Bashiruddin et al., 1999).

Materials and Methods

Total 68 dogs were selected for the study based on clinical signs suggestive of B. gibsoni infection and were subjected to blood smear examination by Giemsa staining technique and PCR. Details like breed, age and sex were also taken for all dogs. Thin blood smears were made from peripheral blood collected aseptically from ear tips which were later stained with Giemsa staining solution as described by Fukumoto et al., 2001. Parasitemia was determined, by observing blood smears under light microscopic examination with 100x magnification. Whole blood from saphenous / cephalic vein was collected into EDTA coated vials and were stored at – 20oC for DNA isolation. Two milliliters for blood was used for DNA extraction by HiPurATM SPP Blood DNA Isolation Kit (Himedia®). The extracted DNA (50 μl) was stored at – 20oC for PCR amplification. PCR was set up in 25 μl reaction mixture which consisted 12.5 μl of PCR Master Mix, 1.0 μl of forward and reverse primer each, 5 μl of template DNA, 2.0 μl of Dimethyl sulfoxide (Genie®) and 5.5 μl of autoclaved triple-distilled water. PCR amplification was done as per Inokuma et al. (2004) with initial denaturation of 95 oC for 5 min, 35 cycles of denaturation (30 sec), annealing (30 sec), extension (90 sec) at 95 oC, 58 oC and 72 oC respectively. Final extension was done for 5 min at 72 oC. For thermocycling, Eppendorf® Master Cycler Gradient was used.

Species specific primers specific for 18S rRNA gene Gib599 forward and Gib1270 reverse as described by Inokuma et al. (2004) were used for PCR amplification with expected product size of 672 bp (Table 1).

Table 1: Showing forward and reverse primers used for the molecular diagnosis of Babesia gibsoni infection in dogs

Gene Primer Primer Sequence 5’ → 3’ Expected Product Size
18S rRNA Gib599 Forward TCCGTTCCCACAACACCAGC 672 bp
Gib1270 Reverse TCCTCCTCATCATCCTCATTCG

The amplified products were checked on 2% agarose gel electrophoresis. The amplified product was purified and subjected for sequencing at Eurofins Genomics India Private Limited, Bengaluru. The specificity of the sequence was determined by subjecting sequence to Basic Local Alignment Search Tool (BLAST). Neighbor Joining method (MOLE BLAST) was used to create phylogenetic tree for and analyze the similarity between isolates found in the present study and isolates reported earlier. The collected data was statistically analyzed and interpreted as described by Snedecor and Cochran (1994) and discussed.

Results and Discussion

In the present study, 68 dogs were suspected for B. gibsoni infection, in which seven were positive for Babesia gibsoni infection by blood smear examination (Fig. 1) whereas, 9 dogs were found to be positive by PCR. Agarose gel electrophoresis of PCR products revealed the amplification at 672 bp (Fig. 2).

Fig. 1: Infected RBC with paired Babesia gibsoni piroplasms Fig. 2: Agarose gel electrophoresis of test samples showing positive results at L3, L5, L7,  L8 AND L9; L1 and L2 being negative and positive controls respectively.

All the seven dog which were positive by blood smear examination were also shown positive by PCR. The reason behind false negativity of two samples with blood smear examination was assumed to be low parasitemia. The present study shows that PCR analysis was superior to the blood smear examination in diagnosis of the infection confirming the reports of Birkenheuer et al., 2003; Garcia de Sa et al., 2006 and Laha et al., 2013, who found out that molecular analysis by PCR was superior to the routine blood smear examination in diagnosing B. gibsoni infection. Blood smear examination was found to be feasible and quick but the reliability was comparatively lower than that of PCR.

The amplified product was sequenced (Genbank accession number: MG708223) and was found 100% similar with the sequence of B. gibsoni, Asian strain (Fig. 3) available in the Genbank using BLAST (www.ncbi.nlm.nih.gov). Phylogenetic tree (Neighbor Joining method; MOLE BLAST) had shown phylogenetic relationship of the isolate with the other Asian isolates reported earlier. Similar results on B. gibsoni, Asiatic strain were obtained by several authors and the most similarity was found to be reported in north eastern region of India (KF606874.1 and KF606873.1) and Malaysia (KU500918.1 and KU500919.1).

Fig. 3: Phylogenetic relationship of the isolate MG708223 with other asian isolates reported earlier

Incidence of babesiosis caused by B. gibsoni was found to be high in puppyhood stage. Present study revealed positivity in nine dogs were all of them were under three years of age. Out of nine, six dogs were under 1-year age group and three were in 1 – 3 years age group. In the present study Fisher’s exact test revealed relative risk of 3.4 in less than one-year age group, which indicates dogs in the age group of dogs less than one year were 3.4 times being infected by B. gibsoni when compared to 1 – 3 years old age group (P value – 0.04) (Table 2).

Table 2: Age wise incidence of Babesia gibsoni infection in dogs

S. No. Age Group No. of Animal’s Positive No. of Animal’s Negative Total P value Relative Risk
1 0 – 1 year 6 8 14 0.043* 3.4
2 1 – 3 years 3 21 24
3 ˂ 3 years 0 30 30
4 Total 9 59 68

P value ≤ 0.05 was found to be significant. Incidence of the disease was found to be high in young age group more than the adult dogs and the results were in concordance with the results of Selvaraj et al. (2010). The present study shows similar reports with high incidence of disease in young animals. Tizard (2004) opined that, underdeveloped immunity in the young dogs when compared to elder dogs was a possible factor for occurrence of babesiosis in young age group. Various breeds of dogs like Great Dane, Doberman, Spitz, Terrier, Irish setter, Pug and Non-descript dogs were found to be positive in the present study. Out of 68 dogs suspected for babesiosis, 47 were found to be male dogs and 21 were female dogs, in which seven male and two female dogs got infected by B. gibsoni where no statistical difference was present by Fisher’s exact test. The observation correlates with Hornok et al. (2006) and Amritpal et al. (2014), who reported that, statistically nonsignificant difference was noticed in the prevalence of B. gibsoni among various breeds and nondescript dogs.

In the present study conducted on 68 dogs, nine were found to be positive for Babesia gibsoni infection by blood smear examination and / or by PCR. The Babesia species identified in the present study was found to be of Asiatic strain by sequencing and BLAST analysis.

Conclusion

It can be concluded that PCR technique was found to be sensitive in diagnosing B. gibsoni infection in canines when compared to the conventional methods. Incidence of Babesia gibsoni infection was found to be affecting significantly in young age group. No significant difference was present in incidence of the disease sex-wise or among various breeds of the dogs.

Acknowledgement

The authors are grateful to the Dean, Rajiv Gandhi Institute of Veterinary Education and Research, Puducherry; Head, Department of Veterinary Medicine and Head, Department of Veterinary Biochemistry for providing necessary guidance and facilities for the work.

References

  1. Amritpal S, Harkirat S, Singh NK, Singh ND, Rath SS, (2014). Canine Babesiosis in Northwestern India: Molecular Detection and Assessment of Risk Factors. Research International. Volume 2014, 1 – 5.
  2. Ayoob, A. L., Hackner. S. G. and Prittie, J. (2010). Clinical management of canine babesiosis. Vet. Emerg. Critical Care. 20 (1), 77–89.
  3. Bashiruddin, J.B., Camma, C., Rebelo, E. (1999). Molecular detection of Babesia equi and Babesia caballi in horse blood by PCR amplification of part of the 16S rRNA gene. Parasitol. 84 (1 – 2), 75–83.
  4. Beugnet, F and Moreau, Y. (2015). Babesiosis, Rev. Sci. Tech. Off. Int. Epiz., 34 (2), 627-639.
  5. Birkenheuer, A. J., Correa, M. T., Levy, M. G. and Breitschwerdt, E. B., (2005). Geographic distribution of babesiosis among dogs in the United States and association with dog bites: 150 cases (2000–2003). Am. Vet. Med. Assoc. 227 (6), 942–947.
  6. Birkenheuer, A. J., Levy M. G., and Breitschwerdt, E. B. (2003). Development and Evaluation of a Seminested PCR for Detection and Differentiation of Babesia gibsoni (Asian Genotype) and canis DNA in Canine Blood Samples, Journal of Clinical Microbiol. 41 (9), 4172–4177.
  7. Fukumoto, S., Xuan, X., Shigeno, S., Kimbita, E., Igarashi, I., Nagasawa, H., Fujisaki, K. andMikami, T. (2001). Development of a polymerase chain reaction method for diagnosing Babesia gibsoni infection in dogs. Vet. Med. Sci. 63 (9), 977–981.
  8. Garcia de Sa, A., Cerqueira, A. M. F., O’Dwyer, L. H., Macieira, D. B., Abreu, F. S., Ferreira, R. F., Pereira, A. M., Velho, P. B. and Almosny, N. R. P. (2006). Detection and molecular characterization of Babesia canis vogeli from naturally infected Brazilian dogs. J. Appl. Res. Vet. Med. 4 (2), 163–168.
  9. Hornok, S., Edelhofer, R. and Farkas, R. (2006). Seroprevalence of canine babesiosis in Hungary suggesting breed predisposition. Parasitol. Res. 99: 638–642.
  10. Inokuma, H., Yoshizaki, Y., Matsumoto, K., Okuda, M., Onishi, T., Nakagome, K., Kosugi, R. and Hirakawa, M. (2004). Molecular survey of Babesia infection in dogs in Okinawa, Japan. Parasitol. 121 (3 – 4), 341–346.
  11. Laha, R., Bhattacharjee, K., Sarmah, P. C., Das, M., Goswami, A., Sarma, D. and Sen, A. (2013). Babesia infection in naturally exposed pet dogs from a northeastern state (Assam) of India: detection by microscopy and polymerase chain reaction. Parasitol. Diseases 38 (4), 389–393.
  12. Samradhni, D., Maske, D. K., Shobha, R. and Shinde, P. N. (2005). Bionomics and haemodynamics in blood protozoal infections in dogs from Nagpur. Indian Journal of Animal Health. 44: 57–66.
  13. Selvaraj, P., Senthil Kumar, K, Vairamuthu, S., Prathaban, S. and Srinivasan, S. R. (2010). Babesia gibsoni – An emerging challenge in canine pediatric practice in Chennai. Tamilnadu J. Vet. & Animal Sciences. 6 (3), 122-124.
  14. Selvi, D., Vijayalakshmi, P., Sreekumar, R and Lakkawar, A. W. (2011). Management of Babesia gibsoni infection in a Rottweiler pup. J. Vet. Med. 31 (3), 52.
  15. Snedecor, G. W. and Cochran, W. G. (1994). Statistical methods. 8th edition, Iowa State University Press, USA.
  16. Solano-Gallego, L. and Baneth, G. (2011). Babesiosis in dogs and cats—expanding parasitological and clinical spectr; Vet. Parasitol. 181 (1), 48– 60.
  17. Tizard, I. (2004). Veterinary Immunology – An introduction. 7th Edn., ISBN, W. B. Saunders Company, Pennsylvania, USA.
Abstract Read : 79 Downloads : 21
Previous Next
Close