Sheep genetic resources stand out unique in diverse livestock species in India with shorter lambing interval, fast growth rate and no social taboos attached. Sheep contribute about 238.8 million kg meat and 40 million kg wool annually; and meat is the major produce. This is not sufficient to meet the demand of ever increasing human population for quality protein. To meet this demand from our sheep breeds seems unachievable due to their low productive and reproductive efficiency. Therefore, alternate strategy is to uplift the genetic potential of sheep breeds using appropriate selection methods for higher litter size or twinning.

The ovulation rate and litter size can be genetically regulated by a set of different genes. These multiple genes influencing fecundity/ ovulation rate in animals are collectively named as fecundity (Fec) genes (Davis et al., 1982) which can be targeted to identify DNA markers significantly influencing litter size in sheep. Some of the fecundity genes identified are BMPR1B (FecB), BMP15 and GDF9 genes. In FecB, one mutation and in BMP15, eight different mutations have been discovered with each producing the same phenotype. Therefore, these mutations in fecundity genes offers tool for selection of highly prolific animals.

Kenguri is a medium sized sheep breed of Karnataka known to thrive well under scarcity condition and sparse vegetation and has higher meat production potential (Jain et al., 2004; Appannavar et al., 2010). However, the reproductive potential of this breed is poor. Therefore, to improve litter size/ fecundity in Kenguri sheep and evolve new strain of Kenguri sheep, introgressing FecB gene is substitute strategy.  For this, NARI Suwarna strain developed at Nimbkar Agricultural research Institute (NARI), Phaltan, Pune, Maharashtra was considered as the choice of sheep suitable for this agro-climatic condition and has shown to yield 33% increase in productivity and income for shepherds. Keeping the potential of Kenguri sheep for mutton production and success of NARI in introducing FecB gene, the present investigation was designed to introgress FecB gene from NARI Suwarna into Kenguri without compromising on its physical attributes. In addition to FecB gene, Bone morphogenetic protein 15 (BMP15) was also investigated in Kenguri and Kenguri x NARI Suwarna strain of sheep. BMP15 gene is also known as FecX (Galloway et al., 2000) and is an X linked gene (FecX locus) of sheep belonging to TGF-β family. The BMP15 protein is a paracrine factor that stimulates follicle growth, granulosa cell proliferation and cell-survival signaling (Demars et al., 2013). BMP15 is an oocyte-derived growth factor that is essential for follicular development in sheep (Hanrahan et al., 2004). The protein is expressed in primary stage of follicular development onwards and acts within the ovaries (Nicol et al., 2009). Till date, 8 mutations related to prolificacy have been identified in the sheep BMP15 gene. Out of 8, six mutations (FecX^I, FecX^H, FecX^B, FecX^G, FecX^L, FecX^R) produce the same phenotype i.e. increased ovulation rate or litter size in heterozygous carriers and sterility in homozygous carriers. However, for FecX^Gr and FecX^O mutations, homozygous ewes are highly prolific. BMP15 was found to be associated with prolificacy in Inverdale, Lacaune, Belclare and Small Tailed Han sheep. Therefore, BMP15 gene was also targeted to identify DNA markers of higher prolificacy/ fecundity.

Materials and Methods

Approximately 10ml of blood samples were collected aseptically from 30 each of Kenguri and Kenguri x NARI Suwarna strain of sheep maintained at the Instructional Livestock Farm Complex, Veterinary College, Bidar. Blood samples were collected, transported and stored according to standard procedure. These blood samples were used for genomic DNA (gDNA) extraction according to Phenol Chloroform method (Sambrook and Russel, 2001) with minor modifications. Isolated gDNA was subjected for analysis of purity and concentration by spectrophotometer reading and for quality assessment using 0.8% agarose gel electrophoresis. Working DNA was prepared from high purity stock DNA to contain 50ng of gDNA/µl.

Amplification of FecB and BMP15 Genes in Ovis aries

Using gene specific primers, 190bp region in exon2 of FecB and 434bp sequences in exon2 of BMP15 genes were amplified in the gDNA samples of Kenguri and Kenguri x NARI Suwarna strain of sheep. For amplification of FecB gene primers (Forward- CCAGAGGACAATAGCAAAGCAAA and Reverse- CAAGATGTTTTCATGCCTCATCAACACGGTC) reported by Davis et al. (2002) were utilized. New primers were designed to amplify partial exon 2 region of BMP15 gene (forward- AGAGCCACTGTGGTTTACCG and reverse- GATGCAATACTGCCTGCTTG). Primers were designed by referring the BMP15 gene sequences of Ovies aries (NC–019484.2) available publicly at NCBI database with the help of primer 3 online softwares (Koressaar and Remm, 2007; Untergrasser et al., 2012). These primers were inspected for their properties using oligoanalyzer software (http://eu.idtdna.com/calc/analyzer) and for their specificities using primer BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/).

To ascertain ideal level of each components of PCR and thermal profile, different combinations of reaction mixture and thermal profiles were used for amplification and the acceptable concentration of reaction components and temperature profiles were used further for amplification of Fec-B and BMP15 genes in gDNA samples (Table 1 and Table 2).

Table 1: The reaction composition for amplification of FecB and BMP15 genes in Sheep

The reaction mixture was prepared according to standard procedure and amplification in final volume of 25µl was carried out in a thermocycler (Biorad iCycler, USA). Specific amplification of Fec-B and BMP15 genes was confirmed by resolving the amplicons on 1.5% (w/v) agarose gel in a horizontal submarine agarose gel electrophoresis unit and checking under the UV Gel documentation system (Biorad, USA).

Table 2: Thermal profile for amplification of FecB and BMP15 genes in Sheep

Restriction Fragment Length Polymorphism (RFLP) Analysis of Fec-B and BMP15 Genes

The specific 190bp and 434bp sized amplicons of Fec-B and BMP15 genes were subjected for RFLP analysis using AvaII and StuI restriction enzymes, respectively. The restriction site of StuI within the 434bp amplicon of BMP15 gene was identified using NEB-cutter V2.0 online tool (http://tools.neb.com/NEBcutter2/). This site had a reported SNP, which was identified using ensemble database (http://www.ensembl.org/index.html).

FecB/AvaII analysis in a total reaction mixture of 25µl containing 5µl of 10X assay buffer of RE, 10U of restriction enzyme and 19µl of amplicons. Similarly, BMP15/StuI analysis was carried out in a total reaction mixture of 16µl containing 5µl of 10X assay buffer of RE, 10U restriction enzyme and 10µl of amplicons. These reaction mixtures were then incubated at 37°C for 15min and the enzymes were inactivated by heating at 80°C for 20 min. The digested products were resolved along with 100bp DNA ladder on 2.5 % agarose gel and the resultant fragments were analysed under Gel documentation system (Biorad, USA).

Statistical Analysis

The statistical analysis was done using SAS 9.3 package. Allelic and genotype frequencies were calculated using PROC ALLELE procedure. Also, the polymorphic parameters such as Polymorphic information content (PIC), heterozygosity, allelic diversity, and HWE were determined. The presence of variant/genotype in HWE was evaluated using χ² test.

Results and Discussion

Amplification of FecB and BMP15 Genes in Sheep

Uniform and specific amplification of 190bp region of Fec-B gene was obtained in all the gDNA samples of Kenguri and Kenguri x NARI Suwarna strain of sheep. For specific amplification of BMP15 gene, PCR reaction was optimised for annealing temperatures from 56-66˚C and for MgCl₂ concentration from 2.5mM to 3mM in reaction mixture. Though the 434bp region of BMP15 gene was amplified between 59.0-62.5˚C but at 61˚C and at 3mM MgCl₂ specific and bright amplification was observed.

RFLP Analysis of Fec-B and BMP15 Genes in Kenguri Sheep

In Kenguri sheep, Fec-B/AvaII analysis revealed a single band of 190bp representing only ++ genotype (Fig. 1) and genotypes BB and B+ were not observed.

Fig. 1: PCR-RFLP band patterns of ovine Fec-B gene revealed by AvaII restriction enzyme in Kenguri sheep. Lane M: 100bp molecular marker; Lane 1-10: Restriction enzyme digested amplicons (190bp) of FecB gene in Kenguri sheep.

The frequency of ++ genotype was 1.00 and the frequency of ‘+’ allele was 1.00. Similarly, BMP15/StuII analysis has revealed single pattern consisting of 434bp, 362bp and 72bp bands representing AB genotype (Fig. 2) and AA and BB genotype were not observed. The frequency of AB genotype was 1 and the frequency of each A and B alleles was 0.5. The polymorphic parameter such as polymorphic information content (PIC), heterozygosity, allelic diversity and test for analysis of Hardy-Weinberg equilibrium (HWE) for Fec-B and BMP15 genes in Kenguri sheep is given in Table 3. The analysis revealed moderate PIC values and departure of Kenguri population from HWE.

Fig. 2:  PCR-RFLP band patterns of ovine BMP15 gene revealed by StuI restriction enzyme in Kenguri sheep. Lane M: 50bp molecular marker; Lane 2-9: Restriction enzyme digested amplicons (434bp, 362bp and 72bp) of BMP15 gene in Kenguri sheep.

Table 3: PIC, Heterozygosity, Allelic diversity and test for HWE in sheep

RFLP Analysis of Fec-B and BMP15 Genes in Kenguri x NARI Suwarna Strain of Sheep

In Kenguri × NARI Suwarna strain of sheep, Fec-B/AvaII analysis identified two band patterns- one pattern with 190bp and 160bp representing B+ genotype and another band pattern with single band of 190bp representing ++ genotype (Fig. 3). 30bp band in B+ genotype was not visible on gels due to their fast resolution during electrophoresis. The genotype BB was not observed in the investigated population. The frequency of genotype B+ and ++ was 0.766 and 0.233, respectively and the respective frequency of ‘B’ and ‘+’ allele was 0.383 and 0.616. Similarly, BMP15/StuI analysis has produced two band patterns; one pattern with 362bp and 72bp bands representing AA genotype and another pattern with 434bp, 362bp and 72bp bands representing AB genotype (Fig. 4). The frequency of AA and AB genotypes was 0.033 and 0.967, respectively. The respective frequency of A and B allele was 0.516 and 0.484.

Fig. 3: PCR-RFLP band patterns of ovine FecB gene revealed by AvaII restriction enzyme in Kenguri x NARI suwarna sheep. Lane M: 100bp molecular marker; Lane 1- 9: Restriction enzyme digested amplicons (190bp and 160bp) representing B+ genotype of FecB gene; Lane 10-14: Restriction enzyme digested amplicons (190bp) representing ++ genotype of FecB gene.

Fig. 4: PCR-RFLP band patterns of ovine BMP15 gene revealed by StuI restriction enzyme in Kenguri x NARI suwarna sheep. Lane M: 50bp molecular marker; Lane 1-8 and 10-11: Restriction enzyme digested amplicons (434bp, 362bp and 72bp) representing AB genotype of BMP15 gene; Lane 9: Restriction enzyme digested amplicons (362bp and 72bp) representing AA genotype of BMP15 gene.

The polymorphic parameter such as polymorphic information content (PIC), heterozygosity, allelic diversity and test for analysis of Hardy-Weinberg equilibrium (HWE) for Fec-B and BMP15 genes in Kenguri x NARI Suwarna strain of sheep is given in Table 3. The analysis revealed moderate PIC values and departure of Kenguri x NARI Suwarna strain of sheep from HWE.

PCR-RFLP analysis of Fec-B gene has revealed the presence of only ++ genotype in Kenguri sheep and B+ and ++ genotypes in Kenguri x NARI Suwarna strain of sheep. Similar to our results in Kenguri sheep, absence of Fec-B mutation was reported in Macheri (Sudhakar et al., 2014), in Sangsiri sheep of Iran (Jamshidi et al., 2013) and in 5 Egyptian sheep breeds viz. Rahmani (R), Ossami (O), Awassi (A), Barki (B) and Awassi×Barki (A×B) (Amr et al., 2009). On the contrary to our results for Fec-B gene in Kenguri, B+ and ++ genotypes were reported with a frequency of 0.77 and 0.23, respectively, in Garole sheep (Polley et al., 2010) and a frequency of 0.39 and 0.61 for B and + alleles. Likewise, PCR-RFLP analysis of Fec-B gene in Garole sheep revealed BB, B+ and ++ genotypes with a frequency of 0.6, 0.31 and 0.09 and the same in Shahabadi were 0.20, 0.70 and 0.15 (Banerji et al., 2002). In Muzaffarnagari sheep, BB, B+ and ++ genotypes were identified with a frequency of 0.03, 0.41 and 0.54 and allelic frequency of 0.235 and 0.745 for B and + alleles, respectively (Singh et al., 2008). In Nilgiri sheep, Sudhakar et al. (2013) have reported BB, B+ and ++ genotypes of Fec-B with a respective frequency of 0.006, 0.262 and 0.731 and frequency of 0.131 and 0.862 for B and + alleles. Similar to our indigenous breeds, in Hu sheep of China BB, B+ and ++ genotypes of Fec-B gene with a respective frequency of 0.33, 0.58 and 0.09. In Garole×Malpura sheep, RFLP analysis of Fec-B sheep revealed three genotypes namely BB, B+ and ++ with respective frequency of 0.06, 0.73 and 0.20 and the respective frequency of B and + alleles was 0.37 and 0.41 (Kolte et al., 2005).

PCR-RFLP analysis of BMP15 gene has revealed the presence of only AB genotype in Kenguri sheep and AA and AB genotypes in Kenguri x NARI Suwarna strain of sheep. Similar to our results, in Lleyn (Cambridge and Belclare) sheep breeds AA and BB genotype with a frequency of 0.5 and 0.5, respectively were reported (Mullen et al., 2003). Likewise, in Small Tailed Han sheep, AB and BB genotypes with a frequency of 0.60 and 0.40, respectively were reported (Chu et al., 2007). Contrast to our results, BMP15 mutation was reported absent in Garole, Malpura, Kendrapada sheep (Kumar et al., 2008), Nilgiri sheep (Sithi, 2009), Bonpala sheep (Roy et al., 2011), Marwari goat (Aditya et al., 2011), Little tailed Han sheep (Liu et al., 2003) and Iranian Sangsari sheep (Kasiriyan et al., 2009). Interestingly, BMP15 mutation was reported by many researchers. In Black Bengal goat, AA, AB and BB genotypes were reported with a respective frequency of 0.44, 0.59 and 0.17 (Ahlawat et al., 2015). Also, Wang et al. (2011) have identified three genotypes (AA, BB and AB) in Fumin White goats and two genotypes (AA, AB and BB) in Tailang black goats using PCR–SSCP and DNA–Sequencing of exon 2 of BMP15 gene. Feng et al. (2014) have identified a mutation in BMP15 gene in Chinese goats.

Although, polymorphism of BMP15 gene was identified in goat, it was not observed in sheep. However, we are foremost in reporting the polymorphism of BMP15 gene in sheep. For this new primers were designed to amplify partial exon2 of BMP15 gene (434bp) and restriction endonuclease enzymes within this region was identified using NEB cutter online program (http://nc2.neb.com/NEBcutter2/). Among these REs, we selected RE site that contained reported SNPs. One such RE was StuI, which was useful for PCR – RFLP genotyping of BMP15 gene in Kenguri and Kenguri x NARI Suwarna strain of sheep. This report of BMP15/StuI polymorphism in sheep breeds/ strains of India is foremost. The χ²-square test to know whether Fec-B and BMP15 genotype frequencies are in Hardy-Weinberg equilibrium revealed significant difference between observed frequencies and expected frequencies that indicate the departure of both Kenguri and Kenguri x NARI Suwarna strain of sheep population for both Fec-B and BMP15 genes from HWE. Similar to these findings, Polley et al. (2010) in Garole, Shahabadi sheep and Ahlawat et al. (2015) in Black Bengal goat had also shown that the populations were not in HWE equilibrium for FecB and BMP15 genotypes.

Conclusion

Polymorphism of FecB gene was not observed in Kenguri but in Kenguri x NARI Suwarna strain of sheep. Likewise, polymorphism of BMP15 gene was not detected in Kenguri but in Kenguri x NARI Suwarna strain of sheep. Investigating the polymorphism of FecB and BMP15 genes in larger population along with other candidate genes of fecundity viz. GDF9, FSHR and GnRHR is suggested. The polymorphism in these genes if identified may be used to associate with fecundity rate/ litter size in sheep. The genetic markers significantly associated with fecundity rate/ litter size will certainly assist the breeders to select sheep with better reproductive performance and make sheep rearing a profitable enterprise.

References

1. Aditya G, Gahlot GC, Mohammad A and SK Ghorui. 2011. Polymorphism of Growth Hormone BMP-15 gene in Marwari goat. Indian Journal of Small Ruminants. 18(1): 32-36.
2. Ahlawat S, Sharma R, Maitra A and Tantia MS. 2015. Current status of molecular genetics research of goats fecundity. Small Ruminant Research. 125: 34-42.
3. Amr A El-Hanafy and El-Saadani DMA. 2009. Fingerprinting of FecB gene in five Egyptian sheep breeds. Biotechnology in Animal Husbandry. 25 (3-4): 205-212.
4. Appannavar MM, Ashok Pawar, Ramachandra B, Tandle MK and Naveen Kumar GS. 2010. Study on growth potential and body measurements of Kenguri breed of sheep. Indian Veterinary Journal. 87: 83-84.
5. Banerji R, Gupta A and Ray K. 2002. Assessment of the FecB mutation in three Indian sheep breeds, including Garole in its native tract, and its effect on prolificacy. Molecular and Human genetics Division. Indian institute of chemical biology, Kolkata, India.
6. Chu MX, Liu ZH, Jiao CL, He YQ, Fang L, Ye SC, Chen GH and Wang JY. 2007. Mutations in BMPR-IB and BMP-15 genes are associated with litter size in Small Tailed Han Sheep (Ovis aries). Journal of Animal Science. 85: 598-603.
7. Davis GH, Montgomery GW, Allison AJ, Kelly RW and Bray AR. 1982. Segregation of a major gene influencing fecundity in progeny of Booroola sheep. New Zealand Journal of Agricultural Research. 25: 525–529.
8. Davis G H, Galloway S M, Ross I K, Gregan S M, Ward J, Nimbkar B V, Ghalsasi P M, Nimbkar B, Gray G D, Subandriyo Inounu I, Tiesnamurti B, Martyniuk E, Eythorsdottir E, Mulsant P, Lecerf F, Hanrahan J P, Bradford G E and Wilson T. 2002. DNA tests in prolific sheep from eight countries provide new evidence on origin of the Booroola (FecB) mutation. Biology of Reproduction. 66: 1869–1874.
9. Demars J, Fabre S, Sarry J, Rossetti R, Gilbert H, Persani L, Tosser-Klopp G, Mulsant P, Nowak Z, Drobik W, Martyniuk E and Bodin L. 2013. Genome-Wide Association Studies Identify Two Novel BMP15 Mutations Responsible for an Atypical Hyperprolificacy Phenotype in Sheep. PLoS Genetics. 9(4): e1003482.
10. Feng T, Chu MX, Cao GL, Huang DW, Di R, Liu QY, Pan ZY, Jin M and Zhang YJ. 2014. Screening for S32G mutation of BMP15 gene in 18 goat breeds. Turkish Journal of Veterinary and Animal Sciences. 38, 463-468
11. Galloway SM, Mcnatty KP, Cambridge LM, Laitinen MP, Juengel JL, Jokiranta TS, Mclaren RJ, Luiro K, Dodds KG, Montgomery GW, Beattie AE, Davis GH and Ritvos O. 2000. Mutations in an oocyte-derived growth factor gene (BMP15) cause increased ovulation rate and infertility in a dosage-sensitive manner. Nature Genetics. 25: 279-283
12. Hanrahan JP, Gregan SM, Mulsant P, Mullen M, Davis GH, Powell R and Galloway SM. 2004 Mutations in the genes for oocyte-derived growth factors GDF9 and BMP15 are associated with both increased ovulation rate and sterility in Cambridge and Belclare sheep (Ovis aries). Biology of Reproduction. 70: 900-909.
13. Jain A, Kulkarni VS, Govindaiah MG, Aswathnarayana T and Sadana DK. 2004. Evaluvation of Kenguri sheep breed of Karnataka. In. Livestock biodiversity vis-a-vis resource exploitation: An introspection Proceedings of National Symposium at NBAGR, Karnal. pp.125.
14. Jamshidi R, Kasirian M M and Rahimi G A. 2013. Application of PCR-RFLP technique to determine Booroola gene polymorphism in the Sangsari sheep breed of Iran. Turkish Journal of Veterinary and Animal Sciences. 37: 129-133.
15. Kasiriyan MM, Hafezeyan H, Sayazadeh H, Jamshidi R, Asghari SR, Irajeyan GH and Buesagh H. 2009. Genetic polymorphism of FecB and BMP15 and its association with litter size in Sangsari sheep breed of Iran. Journal of Animal and Veterinary Advances. 8: 447-453.
16. Kolte AP, Mishra AK, Kumar S, Arora A L and Singh VK. 2005. A study on effect of carringFecB gene on body weight in Garole and Garole×Malpura sheep. Asian-Australasian Journal of Animal Sciences. 18: 1379-1382.
17. Koressaar T and Remm M. 2007. Enhancements and modifications of primer design program Primer3. Bioinformatics. 23:1289-1291.
18. Kumar S, Mishra AK, Kolte AP, Dash SK and Karim S. 2008. Screening for Booroola (FecB) and Galway (FecX^G) mutations in Indian sheep. Small Ruminant Research. 80: 57-61.
19. Liu SF, Jiang YL and Du LX. 2003. Studies of BMPR1B and BMP15 as candidate genes for fecundity in little tailed Han sheep. Acta Genetica Sinica. 30: 755-760.
20. Mullen M, Hanarahan JP, Galloway SM and Powell R. 2003. Source of mutation with large effect on ovulation rate in Belclare sheep. In: proceedings of the Agricultural Research Forum, Tullamore, Ireland. p. 84.
21. Nicol L, Bishop SC, Pong-Wong R, Bendixe NC, Holm LE, Rhind SM and Mcneilly AS. 2009 Homozygosity for a single base-pair mutation in the oocyte-specific GDF9 gene results in sterility in Thoka sheep. Reproduction. 138: 921-933.
22. Polley S, De S, Brahma B, Mukherjee A, Vinesh PV, Batabyal S, Arora JS, Pan S, Ashis Kumar K, Datta TK and Goswami SL. 2010. Polymorphism of BMPR1B, BMP15 and GDF9 fecundity genes in prolific garole sheep. Tropical Animal Health and Production. 42: 985–993.
23. Roy J, Polley S, De S, Mukherjee A, Batabyal S, Pan S, Brahma B, Datta T and Goswami S. 2011. Polymorphism of Fecundity Genes (FecB, FecX, and FecG) in the Indian Bonpala Sheep. Animal Biotechnology. 22: 151-162.
24. Sambrook J and Russel DW. 2001. Molecular Cloning- A Laboratory Manual. 3rd Edition. Cold Spring Harbor Laboratory, New York.
25. Singh RV, Sivakumar A, Sivashankar S and Das G. 2008. Evalution of the Booroola (FecB) gene in Muzaffarngari sheep. In: Use of the FecB (Booroola) gene in sheep-breeding programs (Eds. SW Walkden-Brown, JHJ van der werf, C Nimbkar and VS Gupta) Proceedings of Australian centre for International Agricultural Research, Canberra. pp. 223-224.
26. Sithi MI. 2009. Polymorphism of Bone Morphogenetic protein 15 (BMP15) gene and its potential as a candidate gene for the prolificacy of Nilgiri sheep, M.V.Sc Thesis, Tamil Nadu Veterinary and Animal Sciences University, Chennai. India.
27. Sudhakar A. Rajendran R and Rahumathulla P S. 2013. Detection of Booroola (FecB) mutation in Indian sheep Nilagiri. Small Ruminant Research. 113: 55– 56.
28. Sudhakar A, Sithimarjitha I, Pramod S and Rajendran R. 2014. Polymorphism of FecB gene in Mecheri sheep of India. Journal of Cell & Tissue Research. 14(1): 4055-4058.
29. Untergrasser A, Cutcutache I, Koressaar T, Ye J, Faircloth B C, Remm M and Rozen S G. 2012. Primer3 – new capabilities and interfaces. Nucleic Acids Research. 40: e115.
30. Wang Y Q, Li Y X, Zhang N, Wang Z B and Bai J Y. 2011. Polymorphism of exon 2 of BMP15 gene and its relationship with litter size of two Chinese goats. Asian-Australasian Journal of Animal Sciences. 24: 905-911.