NAAS Score 2018

                   5.36

Declaration Format

Please download DeclarationForm and submit along with manuscript.

UserOnline

Free counters!

Previous Next

Nucleotide Sequence Polymorphism within Exon 1 of Aquaporin 7 Gene and Its Association with Semen Quality in Murrah Buffaloes

Ragini Kumari K. P. Ramesha Rakesh Kumar Beena Sinha P. Divya
Vol 8(2), 137-145
DOI- http://dx.doi.org/10.5455/ijlr.20170829060835

The present study was conducted on Murrah bulls (n= 69) with the objectives of identifying single nucleotide polymorphisms (SNPs) in targeted regions (exon 1 and its flanking intronic region) of AQP7 gene and analyzing their association with semen quality traits in Murrah bulls. Genomic DNA was isolated by using high salt method from blood of Murrah bulls. Targeted region of 459 bp of AQP7 gene was amplified using polymerase chain reaction (PCR). The PCR products were further subjected to single strand conformation polymorphism analysis (SSCP). PCR-SSCP analysis revealed three unique band patterns by silver staining of the polyacrylamide gels. BioEdit software (version 7.2) were used for detecting SNPs. Comparative sequence analysis of AQP7 gene in Murrah bulls with Bos taurus (Ensemble Ref Seq: ENSBTAG00000020105) revealed eleven nucleotide change, out of which three SNP were observed among Murrah bulls. Among these all, pattern 2 of exons 1 have significantly higher mean sperm concentration (p<0.01). Association analysis of exon 1 indicated that hypo-osmotic swelling reactivity in frozen semen was significantly influenced (P<0.05). These findings may suggest that there is genetic variation at exon 1 of AQP7 gene for better sperm quality which would serve as potential genetic marker(s) for semen quality traits in buffalo.


Keywords : AQP7 Gene Murrah Buffalo PCR-SSCP SNP

Introduction

Aquaporin 7 (AQP7) gene is member of aqua-glyceroporins which is non-selective water channels and permeable to glycerol, urea, small non-electrolytes and water (Borgnia et al., 1999; Agre et al., 2002; Ishibashi et al., 2002). Its protein is reported to be present in elongated spermatids, testicular spermatozoa, residual bodies, middle piece and the anterior tail portion of ejaculated sperm (Calamita et al., 2001; Suzuki-Toyota et al., 1999). AQP7 gene has been mapped on Bos taurus autosome 8 (BTA-8) and spans  nearly 16.25 kilobase pairs comprising of 8 exons out of which seven are coding exon and one is non coding (exon 8). Since, AQP7 gene is expressed at the tail of spermatids and spermatozoa in the human testis which helps in differential expression pattern and different motility rates between infertile and fertile ejaculated human sperms (Suzuki-Toyota et al., 1999; Saito et al., 2004). Suzuki-Toyota et al. (1999) reported its role in spermatogenesis which is evident by transient expression of AQP7 mRNA in late phase of spermatogenesis. Calamita et al. (2001) also observed that AQP7 gene exist in epididymal spermatozoa that involved in maintenance of the sperm quality through sperm maturation by transporting glycerol, urea and small non-electrolytes from epididymal fluid. As AQP7 gene, involved in providing permeability to glycerol, it might also involve in the glycerol permeability of sperm during cryopreservation.

Direct selection for semen quality traits, including semen volume per ejaculate, sperm motility, sperm concentration, and so on, is too difficult because of their low heritability (Mathevon et al., 1998). Hence, candidate genes which having the major effect on semen quality traits would serve as a beneficial marker towards selection for semen quality traits. Ma et al. (2011) and Kumar et al. (2014) simultaneously reported that Single Nucleotide Polymorphisms (SNPs) of AQP7 gene of exon 2 and 3 to be associated with acrosome integrity, motility, percentages of viable sperm and post thaw motility in cattle. However, reports on AQP7 gene variants and their association with Sperm quality in Buffalo bulls are by and large lacking. Keeping in view the importance of AQP7 gene, the present study was undertaken to determine the genetic polymorphism in AQP7 gene and to associate the observed genetic polymorphisms with sperm quality traits in Murrah bulls, which may be useful for further genetic improvement of buffalo bulls for sperm quality and may also be utilized as a genetic marker to select appropriate animals.

Materials and Methods

Genomic DNA Isolation

The study was conducted on Murrah buffalo bulls (n=69) which were maintained at Nandini Sperm Station, Hessarghatta, Karnataka and Livestock Training Centre, Dharwad, Karnataka. Genomic DNA was isolated from whole blood (10 ml) by high salt method as described by Miller et al. (1988). Agarose gel electrophoresis and UV spectrophotometer were used to analyse the quality and quantity of DNA. The ratio between OD260 and OD280 was observed for each DNA sample and sample with ratio of 1.8 was considered good and used for further analysis. For preparing the working solution of DNA, the stock was diluted to 100 ng/µL and then stored at -20°C for utilizing it as DNA template in PCR.

Measurement of Sperm Quality traits

Semen quality parameters viz., sperm concentration, post thaw motility and semen volume per ejaculate for each bull under study were recorded from April 2014 to March 2015 with the help of records available in the concerned semen station using SMILE software, IMV technologies, France. The above data were divided into three season consisting of rainy (July to October), winter (November to February) and summer (March to June) season. Two other semen parameter viz., sperm viability and HOS reaction were estimated with the help of standard procedures in both fresh and frozen semen in all the three season. Eosin-nigrosine staining procedure was used for determination of sperm viability (Bloom, 1950). Method as described by Correa and Zavos (1994) was used for HOS reactivity through which functional integrity of plasma membrane of spermatozoa was evaluated.

PCR Amplification and Sequencing Analysis of PCR-SSCP Products

The Polymerase chain reaction (PCR) amplification of exon 1 of AQP7 gene was carried out using forward 5’-GAAGGGGTGCTATTTTGGGC-3’ and reverse 5’-AGGCAGCAACTCAGGACTAA-3’ primers. The above primer was designed using Primer 3 (V.0.4.0) online software which is based on the reference sequence of Bos taurus cattle AQP7 gene (Ensemble Ref Seq: ENSBTAG00000020105). The primer was procured from Amnion Biosciences Pvt. Ltd., Bengaluru. Sequence of primers, its nucleotide numbers, targeted region, and product size are given in Table 1.

Table 1: Primer sequences used to amplify exon 1 of AQP7 gene in Murrah bulls

Exon Sequence Location of  exon on gene (AQP7) Product size (bp) Ta (°C)
1 F-GAAGGGGTGCTATTTTGGGC

R- AGGCAGCAACTCAGGACTAA

601-841 459 58

F=forward; R=Reverse; bp=Basepair; Ta=Annealing Temperature

PCR amplification was carried out on 50 ng/ μl of genomic DNA in programmed thermal cycler (Genetix, India comprising the reaction mixture volume of 25 μl. The reaction mixture consists of 2.5 μl of 10x PCR assay buffer containing 1.5 mM MgCl2, 0.25 μl for each forward and reverse primers, 1 μl of genomic DNA, 2.0 μl of 2.5 mM deoxynucleotides mix, 1 μl of 1 U/μl Taq DNA polymerase and final dilution was made by adding 18 μl of nuclease free water. The PCR amplification was performed using initial denaturation at 94 °C for 5 min, followed by 35 cycles with denaturation at 94 °C for 1 min, annealing temperature of 58 °C for 1 min, and extension at 72 °C for 1 min, followed by a final extension at 72 °C for 5 min. The PCR amplified products (Fig. 1) were detected at 120 V on 1.5% agarose gel stained with ethidium bromide.

Fig. 1: PCR amplification of exon 1 of AQP7 gene in Murrah bull (L 1-12= 459bp; M=100bp)

The PCR products (exon 1) were resolved by polymerase chain reaction single strand conformation polymorphism (SSCP) technique in 40 ml of 10% non-denaturing PAGE (acrylamide and bis-acrylamide, 29:1) gel in vertical gel electrophoresis unit (Cleaver, UK) at 220 V for 7 hours. Technique described by Sambrook and Russell (2001), was used for silver staining of gels and detection of band patterns. Based on the number of bands and mobility shifts, PCR-SSCP variants were recorded manually. Automated ABI DNA Sequencer (Amnion Biosciences Pvt. Ltd., Bengaluru) were used for Custom sequencing of representative samples of each unique PCR-SSCP band patterns. DNA Baser software and BioEdit software (version 7.2) were utilised for SNPs detection by comparing the observed sequence with the reference sequence of Boss taurus AQP7 gene (Ensembl Ref Seq: ENSBTAG00000020105).

Statistical Analysis

Direct counting of the bands appearing in the gels was used for determination of genotypic frequency in the population. The significant effect of SSCP patterns on semen quality parameters was analyzed using the repeated measures of general linear model (GLM) procedure of SAS Version 9.3. The data were classified according to season of semen collection (three groups:  rainy- July to October; summer -March to June; winter-November to February), age group of the bulls (three groups- upto 3 years, 3-4 years and 4-5 years) and  also based on genotype(three SSCP patterns). For association studies two different fixed models were used. First fixed model was used for association of different SSCP pattern with semen parameters viz., volume, concentration, motility and post thaw motility, and the  another model was used for association of SSCP pattern with sperm viability and HOS reactivity.

 

Results and Discussion

Exon 1 of AQP7 gene showed three different conformation patterns on polyacrylamide gel (Fig. 2) for Murrah bulls.

Fig. 2: PCR- SSCP band patterns found in exon 1 of AQP7 gene in Murrah bulls

The frequencies of different patterns viz., pattern P1, pattern P2 and pattern P3 in were 0.5507, 0.2174 0.2319, respectively. Representative samples of each pattern were custom sequenced for confirmation of the mobility shift. For determining of SNPs in targeted region (exon 1) in AQP7 gene, reference sequence (Ensembl Ref Seq: ENSBTAG00000020105) of Boss taurus was aligned with sequencing results of each animal for each targeted region using DNA Baser and BioEdit software (version 7.2) and its respective deduced amino acid variations (Fig. 3 and 4.).

Fig. 3: CLUSTAL W Multiple sequence Alignment of exon 1 (AQP7 gene) SNPs in Murrah bulls. Reference sequence (Ensembl Ref Seq:  ENSBTAG00000020105)

 

 

 

Fig. 4: Sanger Trace figure of different PCR-SSCP variant sites of exon 1 of AQP7 gene in Murrah bulls

On the basis of comparative sequence analysis with Bos taurus, eleven nucleotide changes were found, out of which five were present in exonic region and six in intronic region. Three SNPs were present in Murrah bulls when compared among them, with two SNPs T677G and T753C in exonic region and leads to change in amino acid from leucine to arginine and proline to threonine, respectively analysed by ExPASy translate tool. The other SNPs C880A was present in intronic region. The observed SNPs in exon 1 of AQP7 gene is presented in Table 2. However, in the absence of any available report regarding the polymorphism study of the particular region (exon 1) of AQP7 gene in any livestock species, comparison is not possible.

Table 2: Nucleotide change observed in targeted region (exon 1) of AQP7 gene in Murrah bulls with respect to Boss taurus. Reference sequence (Ensembl Ref Seq:  ENSBTAG00000020105)

Region Transversion Transition Loci (SNPS) Amino Acid Change
Exon-1 T/G NO T677G Leu→Arg
C/A NO C751A Pro →Thr
NO T/C T753C Pro →Thr
NO C/T C758T Thr →Met
NO T/C T832C Phe→Leu
Intron-1 C/A NO C88OA  
NO C/T C918T
NO G/A G920A
NO C/T C931T
NO C/T C950T
NO A/G A980G

 

 

Association of Genetic Variants of AQP7 Gene with Semen Quality

The association analysis of different band pattern of exon 1 of AQP7 gene on semen quality parameters revealed a significant association of band pattern with sperm concentration and HOS reactivity in frozen semen (Table 3). Association analysis indicated the pattern 2 of exon 1 influenced (p<0.01) the sperm concentration. SNP T677G present in pattern P2 of exon 1 was responsible was higher sperm concentration in bulls as compared to other patterns. For pattern P1 the HOS reactivity was significantly (p<0.05) different than the other two pattern.

Table 3: Least squares means (LSM) of semen quality parameters for different patterns of  exon 1 in Murrah bulls

Semen Quality Parameters Exon 1 of Aquaporin 7 gene P-Value
Pattern 1 Pattern 2 Pattern 3
Sperm Concentration(million cells/ml) 835.94b± 51.08 1101.38a±76.93 957.20ab±67.15 0.01**
Volume/ejaculate (ml) 2.61±0.04 2.46±0.15 2.72±0.16 0.46
Motility (%) 56.01±0.66 58.06±2.50 57.73±4.63 0.52
%  live spermatozoa Fresh 87.89±1.75 90.15±1.49 90.00±4.14 0.12
Frozen 57.73±2.53 59.52±2.66 58.00±5.70 0.744
HOST positive (%) Fresh 64.86±2.60 67.27±1.86 68.3±4.43 0.11
Frozen 45.77±1.93 49.96a±1.63 45.67b±2.81 0.04*
Post thaw motility (%) 46.29±0.38 47.46 ±1.22 45.24 ±2.24 0.78

Means with different superscripts were significantly different from each other at (*p<0.05;**p<0.01).

SNP (A→G) in exon 2 of AQP7 gene was reported by Zhao et al. (2009), using PCR-SSCP technique and found its association with semen quality in Simmental and Charolais bulls. Ma et al. (2011) found two SNPs located on exon 2 (A264G) and exon 3 (G371C) of AQP7 gene in the same breeds. Transition A264G had significant association with acrosome integrity (P < 0.01) and sperm motility (P < 0.05) in frozen semen and transversion G371C was found significant for acrosome integrity (P< 0.05), sperm viability (P < 0.05) and sperm motility (P < 0.01) in frozen semen. Kumar et al. (2014) also reported the same SNPs (A264G, G371C) in Frieswal cattle and observed significant effect of A264G (in exon 2) on the sperm motility as well as post thaw motility and G371C (in exon 3) on semen volume, sperm motility, and post thaw motility. No report is available on the association of genetic variants of AQP7 gene on semen quality traits in buffaloes to compare the above findings. The overall least squares means (LSM) for sperm concentration was 904.73±15.81 and HOS reactivity in fresh and frozen semen was 64.86±2.60 and 45.77±1.93, respectively in Murrah bulls. The LSM of sperm concentration with respect to pattern P1, P2 and P3 were 835.94± 51.08, 1101.38±76.93 and 957.20±67.15, respectively. This indicated that the bulls with SSCP pattern P2 had higher sperm concentration than the other SSCP patterns of the exon.  The LSM of HOS reactivity in frozen semen with respect to pattern P1, P2 and P3 were 49.96±1.63, 45.67±2.81 and 41.67±2.78, respectively which indicated that pattern 1 had better functional integrity of plasma membrane of spermatozoa than the other two patterns. The results indicated that there is variability in exon 1 of AQP7 gene and hence may be considered to be marker for selecting bulls with better semen quality parameters in buffalo bulls. However, as there is lack of information for the association between semen quality traits; hence, further validation is needed on a large population.

Conclusion

The study was carried out in Murrah buffalo bulls (n=69) with the objectives to identify genetic polymorphism in the targeted regions (exon 1) of AQP7 gene and to analyze their association with semen quality traits. Subsequent silver staining revealed three unique PCR-SSCP patterns. On the basis of comparative sequence analysis, 11 nucleotide change were detected (5 in exonic and 6 in intronic region), out of which 3 SNPs (two in exon and 1 in intron) were found among Murrah bulls. These SSCP variants were found significantly associated with sperm concentration and HOS reactivity in Murrah bulls. Bulls having SSCP pattern P1were found to high have better functional integrity of plasma membrane of spermatozoa and with pattern P2 were found to have high sperm concentration, and point mutation T677G present in pattern P2 was found to be responsible for this. So, our present study indicated that genetic variants observed in exon 1 of AQP7 gene had been useful for genetic improvement of semen quality traits in Murrah bulls; the same can also be utilized as a genetic marker to select appropriate animals for better sperm quality. Further research needs to be directed in large herd populations to find out the association of allelic variants with traits related to sperm quality, to establish markers and before using them in the Marker Assisted Selection (MAS).

Acknowledgments

The authors are thankful to Director ICAR-NDRI, Karnal; Head, SRS of ICAR-NDRI, Bengaluru; Director Livestock Breeding and Training Centre, Dharwad, and Director Nandini Sperm Station, Hessarghatta, Bengaluru, India, for providing necessary facilities.

References

  1. Agre P, King LS, Yasui M, Guggino WB, Oltersen OP, Fujiyoshi Y, Engel A and Nielsen S. 2002. Aquaporin water channels from atomic structure to clinical medicine. Journal of Physiology. 542(1): 3-16.
  2. Bloom E. 1950. A one minute live-dead sperm stain by means of eosin-nigrosin. Fertility and Sterility. 1: 176-177.
  3. Borgnia M, Nielsen S, Engel A and Agne P. 1999. Cellular and molecular biology of the aquaporin water channels. Annual Review of Biochemistry. 68: 425-458.
  4. Calamita G, Mazzone A, Bizzoca A and Svelto M. 2001. Possible involvement of aquaporin 7 and 8 in rat testis development and spermatogenesis. Biochemical and biophysical research communications. 288: 619-625.
  5. Correa JR and Zavos PM. 1994. The hypo-osmotic swelling test; its employment as an assay to evaluate the functional integrity of the frozen-thawed bovine sperm membrane. Theriogenology. 42: 351-360.
  6. Ishibashi K, Morinaga T, Kuwahare M, Sasaki S and Imai M. 2002. Cloning and identification of a new member of water channel (AQP10) as an aquaglyceroporin. Biochimicaet Biophysica Acta. 1576: 335-340.
  7. Kumar S, Deb R, Singh U, Ganguly I, Mandal DK, Singh R, Sharma S, Singh G, Singh R, Kumar M and Sharma A. 2014. SNPs at exonic region of Aquaporin 7 (AQP 7) gene may effects semen quality parameters among crossbred bulls. Journal of Genetics. 93: 108-112
  8. Ma TH, Liu JF, Zhao RF, Jiang H, Dai LS, Zhao YM, Zhao ZH and Zhang JB. 2011 Association analysis of aquaporin 7 (AQP7) gene variants with semen quality and fertility in bulls. Turkish Journal of Veterinary & Animal Sciences. 35(1): 63-66
  9. Mathevon M, Buhr MM and Dekkers JCM. 1998. Environmental, management, and genetic factors affecting semen production in Holstein bulls. Journal of Dairy Sciences. 8: 3321-3330.
  10. Miller SA, Dykes D and Polesky H 1988. A sample salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Research. 16: 1215.
  11. Saito K, Kageyama Y, Okada Y, Kawakami S, Kihara K and Ishibashi K. 2004. Localization of aquaporin 7 in human testis and ejaculated sperm and possible involvement in maintenance of sperm quality. Journal of Urology. 172: 2073–2076.
  12. Sambrook J and Russell WD. 2001. Molecular cloning. A laboratory manual 1st Cold Spring Harbor Laboratory Press, New York: pp. 1.32-1.34 and 8.14.
  13. Suzuki-Toyota F, Ishibashi K and Yuasa S. 1999. Immunohistochemical localization of a water channel, aquaporin 7 (AQP7), in the rat testis. Celland Tissue Research. 295:  279-285.
  14. Zhao RF, Liu JF and Zhao ZH. 2009. Single Nucleotide Polymorphism of exon 2 of aquaporin7 gene its association with semen quality in cow. China Herbivores. 4: 3-6.
Abstract Read : 366 Downloads : 82
Previous Next
Close