A variety of hepatic tumours has been documented in ducks such as cholangioadenoma, liver cell adenoma, hepatocellular carcinoma and cholangiocarcinoma (Ling et al., 1993). Even though, reports of hepatocellular carcinoma in ducks were found to be frequent in China (Sun et al., 1985), reports from India are very few (Rajan et al., 1989). In China, hepatocellular carcinoma was found to be associated with duck hepatitis B virus (DHBV) infections and aflatoxin B1 exposure (Cova et al., 1994). The current study was intended to study the occurrence of hepatocellular carcinoma in ducks over a one-year period.

Materials and Methods

A total of 112 duck carcasses were examined during the period from March 2018 to April 2019. Detailed necropsy was conducted and gross lesions were documented. Representative tissue samples of liver were collected and fixed in 10 per cent neutral buffered formalin for a minimum period of 48 hours. After fixation, the tissues were washed overnight under running tap water before being processed by routine paraffin block embedding technique for histopathological study. The tissues were sectioned at 5-micron thickness and stained by routine haematoxylin and eosin staining. Special stains such as Masson’s trichrome and Congo red were used to demonstrate relevant tissue components wherever necessary (Suvarna et al., 2018).

Molecular detection of duck hepatitis B virus (DHBV) was attempted by polymerase chain reaction (PCR). For molecular detection, liver samples were collected in sterile 1.5ml Eppendorf tubes and stored at -20ºC until further processing. Total DNA was extracted from liver tissues using conventional phenol-chloroform method (Köchl et al., 2005). Polymerase chain reaction (PCR) was carried out targeting a 128 base pair region of the DHBV polymerase gene using the primers DCD03 ACTAGAAAACCTCGTGGACT and DCD04 GGGAGAGGGGAGCCCGCACG (Wang et al., 2002). Visualization of the PCR products was carried out using gel documentation system (Syngene, USA).

Results and Discussion

Hepatomegaly was observed in 72.32 per cent (81/112) cases. Nodular growths on the liver surface were seen in 8.64 per cent (7/81) of enlarged livers. Histologically, one case (0.89 per cent, 1/112) was identified as hepatocellular carcinoma. Previously, Rajan et al. (1989) observed an incidence of 1.84 per cent of hepatocellular carcinomas in ducks exposed to aflatoxins. The major reason for liver enlargement in other cases were due to amyloidosis (61.61%, 69/112). Other frequent histological lesions noticed in enlarged livers were multifocal hepatocellular necrosis, severe congestion and fatty change. The hepatocellular carcinoma was identified in an 18-month-old White Pekin duck. Grossly, the both liver lobes had 0.5 to 1 cm diameter sized multiple dark red to greyish nodules projecting out from the parenchyma. Further, the cut surface of the liver parenchyma showed multiple lobulations separated by greyish areas (Fig. 1). No gross metastasis was observed in other organs. Microscopically, there were chord-like fibrous tissue bundles proliferating from the capsule, invading the parenchyma creating pseudolobulations (Fig. 2).

The central veins and portal tracts were absent in the areas of pseudolobulation. In a few areas, severely dilated sinusoids containing erythrocytes, giving appearance of hematoma were observed (Fig. 3). Oval to round eosinophilic, proteinaceous fibrin deposits (Fig. 4) of varying size along with ballooning degeneration of hepatocytes were observed in multiple areas. A few areas showed acinar pattern of hepatocytes (Fig. 5) while others had severely proliferating hepatocytes with solid pattern (Fig. 6) with a few vascular lumens showing invasion of proliferating cells (Fig. 7). The histological patterns observed in this case are similar to those reported by Ling et al. (1993), with the exception of vascular invasion.

A few studies were reported from China to identify the cause of development of hepatocellular carcinoma in ducks. In Qidong area of China, both aflatoxin B1 and hepatitis B viruses were considered predisposing risk factors for the development of hepatocellular carcinomas in humans as well as ducks (Sun et al., 1985).

Conclusion

However, in the present study, duck hepatitis B virus (DHBV) could not be detected from the liver with hepatocellular carcinoma. However, previous experimental studies by Cova et al. (1990) have shown that aflatoxin alone is capable of inducing hepatic neoplasms in White Pekin ducks. The present report of hepatocellular carcinoma in the present White Pekin duck could also be due to aflatoxin exposure, supported by the history of feed contamination. The study reveals that hepatocellular carcinoma is infrequent in ducks and the role of aflatoxin need to be further studied to alleviate the problem.

References

1. Cova, L., Wild, C. P., Mehrotra, R., Turusov, V., Shirai, T., Lambert, V., Jacquet, C., Tomatis, L., Trepo, C., & Montesano, R. (1990). Contribution of aflatoxin B1 and hepatitis B virus infection in the induction of liver tumors in ducks. Cancer Research, 50(7), 2156-2163.
2. Cova, L., Mehrotra, R., Wild, C. P., Chutimataewin, S., Cao, S. F., Duflot, A., Prave, M., Yu, S.Z., Montesano, R., & Trepo, C. (1994). Duck hepatitis B virus infection, aflatoxin B1 and liver cancer in domestic Chinese ducks. British Journal of Cancer, 69(1), 104.
3. Köchl, S., Niederstätter, H., & Parson, W. (2005). DNA extraction and quantitation of forensic samples using the phenol-chloroform method and real-time PCR. In Forensic DNA typing protocols (pp. 13-29). Humana Press.
4. Ling, Y. S., Guo, Y. J., & Yang, L. K. (1993). Pathological observations of hepatic tumours in ducks. Avian Pathology, 22(1), 131-140.
5. Rajan, A., Maryamma, K. I., & Nair, M. G. (1989). Aflatoxin induced hepatopathy in pigs and ducks. Journal of Toxicology: Toxin Reviews, 8(1-2), 255-263.
6. Sun, T. T., Wu, S. M., Wu, Y. Y., & Chu, Y. R. (1985). Measurement of individual aflatoxin exposure among people having different risk to primary hepatocellular carcinoma. In Princess Takamatsu Symposia (Vol. 16, pp. 225-235).
7. Suvarna, K. S., Layton, C., & Bancroft, J. D. (Eds.). (2018). Bancroft’s Theory and Practice of Histological Techniques E-Book. Elsevier Health Sciences.
8. Wang, C. Y. J., Giambrone, J. J., & Smith, B. F. (2002). Detection of duck hepatitis B virus DNA on filter paper by PCR and SYBR green dye-based quantitative PCR. Journal of Clinical Microbiology, 40(7), 2584-2590.