NAAS Score 2019

                   5.36

Declaration Format

Please download DeclarationForm and submit along with manuscript.

UserOnline

Free counters!

Previous Next

Pathological Changes and Molecular Detection of Avian Nephritis Virus from Commercial Broiler Chicken

M. Sathiyaseelan R. Kumar A. W. Lakkawar M. G. Nair J. Thanislass K. C. Varshney
Vol 9(2), 236-242
DOI- http://dx.doi.org/10.5455/ijlr.20180917045846

Gout is a metabolic disorder that occurs due to multiple causes including management, nutrition and infection. Avian nephritis virus (ANV) has been associated with nephropathy in commercial broilers. Hence the present study reports detection of ANV by reverse transcriptase polymerase chain reaction (RT-PCR) and its associated pathomorphology in gout affected commercial broiler from Puducherry and Tamilnadu during March 2015 and October 2015. Gout was recorded grossly in 24/120 (20%) and microscopically in 28/120 (23.33%) cases. Out of the 18 samples screened for ANV, 2 (11.11%) samples were found to be positive by RT-PCR. On microscopical examination of kidney moderate to severe dilatation of tubules and focal to multifocal interstitial mononuclear cells infiltration were observed. Isolation and identification of ANV is complicated and time consuming, hence the RT-PCR used in the present study can be a potential diagnostic tool for screening of ANV in the cases of gout and nephropathy in chickens.


Keywords : Avian Nephritis Virus Broiler Chicken Gout Pathology RT-PCR

Nephropathy and subsequent gout is a metabolic disorder resulting in hyperuricemia and is a frequent cause of mass losses in the poultry. Gout is multifactorial in origin which can be infectious, nutritional, toxic, poor management or possibly a combination of factors. Bulbule et al. (2013) reported several outbreaks of gout in commercial broilers in India during 2011 and 2012, causing up to 40% mortality and in these cases, the managemental and nutritional causes were not involved. Among the infectious causes the specific viral diseases often associated with kidney damage and gout are infectious bronchitis virus, avian nephritis virus and chicken astro virus. Avian nephritis virus (ANV) is associated with acute, highly contagious, but typically subclinical disease in chicken. The disease is characterized by diarrhoea, retarded growth, tubulonephrosis, interstitial nephritis, uricosis (gout) and finally death (Mandoki et al., 2006b). The etiological agent, Avian Nephritis Virus belongs to the family Astroviridae and genera Avastrovirus. The family Astroviridae is divided into two genera: Mamastrovirus (mammalian astroviruses) and Avastrovirus (avian astroviruses). In chickens, two astrovirus species, namely chicken astrovirus (CAstV) and avian nephritis virus, which are antigenically and genetically distinct, have been detected.

Avian nephritis virus was first isolated from the rectal contents of a 1-week-old, apparently normal, broiler chicken (Yamaguchi et al., 1979). Serological testing has shown that ANV infections are widespread in commercial chicken in Japan (Imada et al., 1980), Belgium (Decaesstecker and Meulemans, 1991), Hungary (Mándoki et al., 2006a) and Nigeria (Oluwayelu et al., 2012). In a cross sectional study carried out in India, the incidence of avian nephritis was recorded to 36.4% (Bulbule et al., 2013). Ghodasara et al. (2015) reported the pathomorphology, isolation and detection of Avian Nephritis Virus by RT-PCR from field outbreak in commercial broiler in Raipur, Chhattisgarh. Sukumar and Sumitha (2016) and Gogoi et al. (2017) also detected the avian nephritis virus (ANV) from commercial broiler flocks in various parts of south India.

Occurrence of ANV infections has been reported from different parts of the world, however the clinical significance and economic implication of the disease is unclear largely due to the lack of convenient diagnostic tests. Additionally, majority of the diseases/conditions end up finally as gout, differential diagnosis of ANV infections become either difficult or not possible merely on the basis of the clinical and morphological features. It is also difficult to isolate the virus in cell culture due to its comparatively poor growth in primary chicken cells. In addition, antisera specific to antigenically different ANVs for detection of virus antigen by immuno-staining methods are not widely available. Nucleic acid based method like RT-PCR has been widely used for the confirmatory diagnosis of ANV (Mándoki et al., 2006b). The present study reports the gross and microscopic lesions and detection of ANV by RT-PCR in commercial broilers from field outbreaks from Tamil Nadu and Puducherry.

Materials and Methods

The study was carried out on the broiler kidney samples collected between March 2015 and October 2015 from various farms located at Udumalpet, Coimbatore, Salem and Puducherry. A total of 240 kidney samples (both left and right) from 120 broiler birds were collected for further examination. The age of the birds varied from day-old to six weeks. Representative tissue samples fixed in 10% neutral buffered formalin and in absolute alcohol (gout) were processed by paraffin embedding technique for microtomy and 4-5 µm thick sections were prepared and stained by routine haematoxylin and eosin (H&E) for detailed histopathological studies as described by Luna (1968). Parallel sections were also stained by DeGalantha method for gout. For molecular diagnosis kidney samples were collected and stored at -20c.

Extraction of RNA from Tissues

RNA from eighteen kidney samples was extracted with TRI reagent according to the manufacturer’s instructions (SIGMA-ALDRICH). About 30 mg of tissue sample was weighed and triturated with 1ml of TRI reagent for about 10 minutes. The cell lysate was vortexed and homogenized for about 5-10 minutes. The samples were allowed to stand for 5 minutes at room temperature and once again vortexed after adding chloroform (0.2 ml per ml of tri reagent). The mixture was centrifuged at 12000 x g for 15 minutes at 4˚C. From this, the resulting aqueous phase was transferred to a fresh tube and added 0.5 ml of isopropanol (per ml of tri reagent), vortexed and allowed to stand for 5-10 minutes at room temperature. The mixture was once again centrifuged at 12000 x g for 10 minutes at 4˚C which resulted in the formation of RNA pellet on the sides and bottom of the tube. The pellet was washed by adding 1 ml of 75% ethanol (per ml of tri reagent) and air dried. Later it was dissolved by adding 200μl of DEPC treated water and kept at 65˚C for 15-20 minutes to facilitate dissolution. RNA samples were stored at -80˚C until further use. The quality of RNA was checked by using Agarose Gel Electrophoresis (Rio et al., 2010) and by measuring the ratio of A260/A280.

The following set of primer was used for the detection of Avian Nephritis Virus as described by Todd et al. (2010). One step m-MuLv RT-PCR kit (Merck specialities Pvt. Ltd. India) was used for the preparation of reaction mixture.

Table 1: Primer sequence for the detection of ANV

Region of Amplification Primer Sequence (5’-3’) Size
3’-UTR of ANV genome (Nucleotides 6715 to 6896) Forward : ACGGCGAGTACCATCGAG

Reverse : AATGAAAAGCCCACTTTCGG

182 bp

The PCR reaction (total volume 25 μl) contained 3 μl of RNA, 12.5 μl of 2X RT PCR mix, 0.5 μl of RT Enzyme mix, 0.5 μl of RNAse inhibitor, 1 μl (100pmol/μl) of each primer and 6.5 μl of Ultra-pure water. The reaction was carried out in a thermocycler (Eppendorff Inc, USA), with an initial Reverse Transcription at 45˚C for 30 minutes followed by Primary denaturation 94˚C for 2 minutes, Denaturation at 94˚C for 30 seconds, Annealing at 57˚C for 40 seconds, Extension at 72˚C for 30 seconds and final extension at 72˚C for 5 minutes. The amplified products were checked by agarose (1%) gel electrophoresis at 100 volts for 45 minutes.

                                                                  

Result and Discussion

Avian nephritis virus positive birds showed swollen kidneys, prominent ureter and visceral gout (Fig. 1). The other noticeable findings observed was presence of chalky white masses surrounding the heart, kidneys, liver and other organs (Fig. 2). Hence in the present study, broilers birds that had lesions of gout and severe nephrosis were included for further study. In the present study, the occurrence of gout was more in birds less than 3 weeks (18/28, 64.28%). Grossly, gout was recorded in 24/120 (20%) cases.

Fig. 1: Swollen kidneys with chalky white deposits. Fig. 2: Chalky white deposits noticed in the pericardial sac and surface of liver.

Microscopically, gout was recorded in 28/120 (23.33%) cases and in these cases, kidneys showed severe damage of tubules characterized by moderate to severe tubular dilation, necrosis with large deposits of radiating fine needle shaped crystals in the tubular lumen and in the interstitum (Fig. 3). The crystals appeared black against a yellow background on De Galantha staining (Fig. 4). On microscopical examination of kidneys, large to moderate, focal to diffuse interstitial mononuclear cells infiltration were observed (Fig. 5). In some cases, interstitial nephritis characterized by multifocal perivascular and periglomerular lymphoplasmocytic infiltration with follicular pattern (Fig. 6).

Fig. 3: Kidney- Presence of fine needle shaped urate crystals in tubules.

H&E x 400

Fig. 4: Kidney-Fine needle shaped black urate deposits. De Galantha x 200
Fig. 5: Kidney- Diffuse infiltration of

lympho-plasmacytic cells. H&E x 200

Fig. 6: Kidney-Peri glomerular aggregation of mononuclear cells. H&E x 400

The gross and histopathological features observed in the present study concurred with the observations of earlier workers (Ansar et al., 2004; Feizi et al., 2012 and Auda, 2013). Infiltration of lymphoid cells and formation of lymphoid germinal centers in affected tissue is considered to be one of the local immune responses to viral infection (Ghodasara et al., 2015). Histolopathological changes observed in clinical cases of ANV include interstitial nephritis that can also be encountered in infections caused by some strains of avian infectious bronchitis virus (Reece et al., 1992; Imada, 2008; Hewson et al., 2010). Mandoki et al. (2006a) also observed that the histological investigations of ANV are not informative enough to differentiate between the possible causes of gout in young chickens.

Fig. 7: Agarose (1%) gel electrophoresis of RT-PCR product (182 bp) of 3’ UTR of ANV genome. Lane 2&7: Negative, Lane 3&6: Positive, Lane 4: Positive control, Lane 5: 100 bp DNA ladder, Lane 8: Negative control

Isolation and identification of ANV is complicated, time consuming and require special cell lines and ANV specific antiserum for the assay (Yamaguchi et al., 1979).  In addition, antisera specific to antigenically different ANVs for use in the detection of virus antigen by immuno-staining methods are not widely available. Nucleic acid based techniques such as RT-PCR can be used as potential tool for routine and confirmatory diagnosis for ANV (Mandoki et al., 2006b). For the molecular detection of ANV a total number of 18 kidney samples from birds less than 3 weeks of age with characteristic lesions of gout were used. Out of 18 samples, 2 (11.11%) samples were found to be positive for RT-PCR (Fig. 7).

Bulbule et al. (2013) observed higher incidence of ANV (36.4%). Ghodasara et al. (2015) reported the pathomorphology, isolation and detection of avian nephritis virus by RT-PCR from field outbreak in commercial broiler in Raipur, Chhattisgarh. Sukumar and Sumitha (2015) from Tamilnadu detected the avian nephritis virus (ANV) from 2 out of 5 kidney samples of broiler birds died of gout, diarrhoea, runting-stunting syndrome. Gowthaman et al. (2015) also detected the presence of ANV in 2 out of 21 commercial broiler flocks. Recently, Gogoi et al. (2017) studied the incidences of nephropathy in young chicks of certain commercial broiler flocks in the states of Telangana, Andhra Pradesh, Tamil Nadu and Maharashtra and found that 42 out of 96 kidney samples (43.75%) were found to be ANV positive. Mandoki et al. (2006b) from Hungary confirmed the presence of ANV in 36/56 (64%) kidney samples from clinical outbreaks of nephritis and gout by RT-PCR, based on primers located within open reading frame (ORF) 1a, which encodes the non-structural viral protease. Day et al. (2007) detected the ANV in 61/109 (56%) enteric samples of chicken by using an alternative RT-PCR based on the use of degenerate primers located within ORF 1b (RNA polymerase). In the present study, the primer targeting untranslated region (UTR) of the ANV genome between nucleotides 6715 to 6896 were used. The target region was present in the conserved region of capsid protein ORF 2 sequence. According to Todd et al. (2010) the primers designed based on this sequence was reported to be highly sensitive with the product size of 182 bp.

Conclusion

The present study highlighted the prevalence of ANV in the broiler chicken. Visceral gout was the most common gross and microscopic feature of ANV infected birds. The possibility of other viral agents like infectious bronchitis, infectious Bursal disease and chicken astro viral infections cannot be ignored. PCR is the most preferred diagnostic method for the detection of ANV in birds.

Acknowledgement

The authors were thankful to the Dean, Rajiv Gandhi Institute of Veterinary Education and Research, Puducherry, India for providing the necessary facilities for carrying out the research work.

References

  1. Ansar, M., Khan, S.A., Chaudhary, Z.I., Mian1, N.A., Tipu, M.Y. and Rai, M.F. (2004). Effect of high dietary calcium and low phosphorus on urinary system of broiler chicks, Pakistan Vet. J., 24(3): 113-116.
  2. Asish, C.D. (2016). Studies on visceral gout in broiler chicks with special reference to Astrovirus. Thesis submitted to Anand Agricultural University.
  3. Auda, A.D. (2013). Pathological study of the experimentally visceral gout in Nasiriya city broilers. Journal of University of Thi-Qar, 8(3): 1-7.
  4. Bulbule, N.R., Mandakhalikar, K.D., Kapgate, S.S., Deshmukh, V.V., Schat, K.A. and Chawak, M.M. (2013). Role of chicken astrovirus as a causative agent of gout in commercial broilers in India. Avian Pathol., 42(5): 464–473.
  5. Day, J.M., Spackman, E. & Pantin-Jackwood, M. (2007). A multiplex RT-PCR test for differential identification of turkey astrovirus type 1, turkey astrovirus type 2, chicken astrovirus, avian nephritis virus and avian rotavirus. Avian Dis., 51(3): 681-684.
  6. Decaesstecker, M. & Meulemans, G. (1991) An ELISA for the detection of antibodies to avian nephritis virus and related entero‐like viruses. Avian Pathol., 20(3):523-530.
  7. Feizi, A., Dadian, F. and Nazeri, M. (2011). Evaluation the Effect of Dietary Calcium Percentage on Incidence of Gout syndrome in Broiler Chicks. J. Basic Appl. Sci., 5(11): 1750-1755.
  8. Ghodasara, P.D., Prajapati, K.S., Ghodasara, D.J., Joshi, B.P., Thakkar, H., Banerjee, J. and Pal, J.K. (2015). Isolation and detection of avian nephritis virus by RTPCR from commercial broiler flocks affected with visceral gout in India. Indian J. Vet. Pathol., 39(1): 54-57.
  9. Gogoi, S.M., Gulhane, A.B., Deshpande, A.A. and Balaguru, P. (2017). Isolation and Identification of Avian Nephritis Virus from Commercial Broiler Chickens. Anim. Res., 7(2): 299-305.
  10. Gowthaman, V., Singh, S.D., Dhama, K., Barathidasan, R., Srinivasan, P., Saravanan, S., Gopalakrishnamurthy, T.R., Deb, R., Mathapati, B. and Ramakrishnan, M.A. (2015). Detection and partial genetic characterisation of a novel variant of avian nephritis virus in indian poultry flocks showing diverse clinical signs. Acta Veterinaria Hungarica 63(4): 499–507.
  11. Hewson, K., O’Rourke, D. and Noormohammadi, A. 2010. Detection of avian nephritis virus in Australian chicken flocks. Avian Dis., 54(3): 990–993.
  12. Imada, T. 2008. Avian Nephritis, Diseases of Poultry. editors Saif, Y.M., Fadly A.M., Glissen J.R., McDougald L.R., Nolan L.K., Swayne D.E. 12th . Blackwell Publishing, Ames, Iowa. pp. 409-413
  13. Imada, T., Yamaguchi, S., Miura, N. and Kawamura, H. (1980). Antibody survey against avian nephritis virus among chickens in Japan. Inst. Anim. Health Q., 20:79–80.
  14. Luna, L. G. (1968). Manual of histologic staining methods of the Armed Forces Institute of Pathology. 3rd, McGraw Hill, New York, U.S.A.
  15. Mandoki, M., Bakonyi, T., Ivanics, E., Nemes, C., Dobos-Kovacs, M. & Rusvai, M. (2006a). Phylogenetic diversity of avian nephritis virus in Hungarian chicken flocks. Avian Pathol., 35(3): 224-229.
  16. Mandoki, M., Dobos-Kovacs, M., Bakonyi, T. & Rusvai, M. (2006b). Molecular diagnosis of avian nephritis: preliminary report. Vet. Hung., 54(1): 51-60.
  17. Oluwayelu, D.O., Smyth, V. and Todd, D. (2012). Detection of avian nephritis virus and chicken astrovirus in Nigerian indigenous chickens. J. Biotechnol., 11(17): 3949-3957.
  18. Reece, R.L., Howes, K. and Frazier, J.A., 1992. Experimental factors affecting mortality following inoculation of chickens with avian nephritis virus (G-4260). Avian Dis., 36(3): 619–624.
  19. Rio, D.C., Ares, M. Jr., Hannon, G.J. and Nilsen, T.W. (2010). Nondenaturing agarose gel electrophoresis of RNA. Cold Spring Harb Protoc. (6): pdb. prot. 5445.
  20. Sukumar, K. and Sumitha, P. (2016). Incidence of Avian Nephritis from Commercial Broiler Flocks in Palladam Region of Tamil Nadu. Indian Vet. J., 93(05): 77-79.
  21. Todd, D., Trudgett, J., McNeilly, F., McBride, N., Donnelly, B., Smyth, V. J., Jewhurst, H.L. and Adair, B.M. (2010). Development and application of an RT-PCR test for detecting avian nephritis virus. Avian Pathol., 39(3): 207-213.
  22. Yamaguchi, S., Imada, T. and Kawamura, H. (1979): Characterization of a picornavirus isolated from broiler chicks. Avian Dis., 23: 571–581.
Abstract Read : 50 Downloads : 11
Previous Next
Close