NAAS Score 2018

                   5.36

Declaration Format

Please download DeclarationForm and submit along with manuscript.

UserOnline

Free counters!

Previous Next

Screening of E. coli Isolates of Poultry Origin for Extended Spectrum Betalactamases (ESBL) Resistance

S. Amsaveni K. Porteen G. Selvaraju M. Vijaya Bharathi M. Sekar
Vol 8(2), 299-306
DOI- http://dx.doi.org/10.5455/ijlr.20170821033016

A total of thirty two E.coli isolates obtained from poultry intestines were subjected to phenotypic screening of Extended Spectrum Betalactamase (ESBL) and AmpC Betalactamase resistance by novel disc placement method involving both inducer and indicator discs. Among them 14 isolates were indicative of ESBL producers and two were identified as AmpC derepressed mutants. They were also subjected for slime production by Modified Congo Red Agar (MRCA) method and found all were positive by producing dry crystalline black coloured colonies. The simplex PCR was standardized for three genes (TEM, SHV, CTX-M) to run at a same annealing temperature 60°C for 60 sec. The genotypic screening revealed none of the 32 isolates were positive for the above genes. Identification of antibiotic resistance and presence of biofilm producing ESBL E. coli in faeces of poultry origin indicates zoonotic and public health significance which emphasizes routine screening of poultry meat thereby appropriate strategies can be adopted to combat this resistance.


Keywords : Bioflim E. coli ESBL MRCA PCR Poultry

Introduction

Extended-spectrum-beta-lactamases (ESBLs) producing Enterobacteriaceae (ESBL-E) are widely spread in both humans and livestock which makes a zoonotic transfer very likely and its presence in a clinical infection can result in treatment failure. The ESBLs can be difficult to detect because they have different levels of activity against various cephalosporins, so that the choice of which antimicrobial agents to test is critical. The bla genes are the genes encoding the betalactamases which are located on the bacterial chromosome, plasmids, transposons or integrons (Babic, 2006).   More than 200 TEM-type enzymes have been identified, and the majority of them are ESBL-producers (Livermore, 1995).

In recent times many researchers have reported an association between biofilm production and antibiotic resistance. Biofilms are adopted universal strategy responsible for bacterial survival and allows them to use effectively the available nutrients. They largely consist of polysaccharides, which prevents the access of antibacterial agents, antibodies and white blood cells thereby withstanding the host immune responses.

Considering the above points, the present study was designed to determine the distribution of ESBL and AmpC betalactamase resistance in intestinal commensal E. coli isolates obtained from poultry and their ability of in-vitro production of slime, which delivers their zoonotic importance.

 

Materials and Methods

A total of 32 intestines were collected from broiler birds during slaughter in and around Pondicherry. Tied intestines at both sides were collected during slaughter in sterile petri plates and transported to laboratory on ice.  The intestines were cut open under sterile conditions and loopful of content was inoculated in nutrient broth, incubated at 37°C overnight for enrichment. The next day the broth culture was streaked on to MacConkey agar and incubated at 37°C overnight. The suspected lactose fermenting colonies form MacConkey agar were streaked onto eosin methylene blue agar and further incubated. E. coli isolates were identified following the method described by Chessbrough (1984).

Phenotypic Screening of E. coli for Production of ESBL/AmpC by Novel Disc Placement Method

All the E. coli isolates were tested by disc placement method and zone diameters were interpreted as per Rodrigues et al. (2004). The E. coli isolates were inoculated in nutrient broth and incubated at 37°C until it matches with Mc Farland 0.5 turbidity standard. The lawn culture was made on Mueller-Hinton agar (MHA). In the center of the plate, imipenem (10 μg) (Inducer) disc was placed. At the distance of 20 mm, the disc of cefotaxime (30 μg) was placed. From this disc, in a circular manner, clockwise, the discs of cefoxitin (30 μg) (Inducer), ceftriaxone (30 μg), ceftazidime (30 μg), ceftazidime + clavulinic acid (30/10 μg), and aztreonam (30 μg) were placed such that any two adjacent discs were 20 mm apart from center to center. Plates were incubated at 37°C and measure the diameters of zones of inhibition.

Slime Production

Modified Congo Red Agar method (MCRA) plates were prepared as described by Mariana et al. (2009). All the 32 cultures were streaked on the prepared agar plates and incubated at 37°C for 48 hr and for next two days at room temperature. A black colour indicates as positive in contrast with red colonies which is interpreted as negative.

Genotypic Screening

The Standard Reference Strains Used in This Study

  1. coli CTXM & TEM positive Courtesy Dr. Padma Krishnan, IBMS,Taramani (University of Madras, UoM). E. coli A223 positive for TEM, SHV, CTX-M Courtesy Dr. Anand Manoharan, Director, Pushpagiri Research Center. The E. coli isolates were screened for SHV genes, CTX-M and TEM genes according to the procedures described below-

Table 1: Oligonucleotide primers used in this study

Resistance gene Sequence (5′ to 3′)

 

Size (bp)

 

Reference

 

SHV GATGAACGCTTTCCCATGATG

CGCTGTTATCGCTCATGGTAA

214 Kim et. al. (2009)
CTX-M

 

TTTGCGATGCATACCAGTAA

CGATATCGTTGGTGCCATA

590

 

Edelstein et al. (2003)
TEM

 

ATGAGTATTCAACATTTCCG GTCACAGTTACCAATGCTTA 847

 

Machado et al. (2007)

The PCR running conditions for SHV gene is 95°C for 5 min; 35 cycles of 95°C for 60s, 61°C for 60s, 72°C for 60s; 72°C for 5 min. For CTX-M and TEM the annealing temperature alone is changed as 60°C for 30s and 58°C for 60s, respectively. The other conditions remain the same as above. All the above mentioned primers were custom synthesized by Sigma-Aldrich Corporation, India and used in this study. OneTaq® 2X Master Mix with Standard Buffer New England Biolabs (Ipswich, MA, USA).

Results and Discussion

All the 32 isolates obtained from enriched intestinal contents were indicative of lactose fermenting colonies and on biochemical examination indicative of E. coli. Similarly, McPeake et al. (2005) and Samantha et al. (2015) isolated E. coli from faeces of apparently healthy chickens. The phenotypic screening by novel disk placement method in this study indicates 44 per cent of them were ESBL producers and 6.3 per cent were AmpC derepressed mutants (Table 2, Fig. 1,2,3&4). Whereas, Nagdeo et al. (2012) screened clinical isolates of Gram-negative bacilli isolated from humans by the similar novel disk placement method and showed 98.51 per cent were ESBL producers thus indicating that screening for resistance with at least two third-generation cephalosporins could confirm the presence of ESBL in a majority of the isolates further declaring it an affordable and reliable method for detection of various β-lactamases. Chah and Oboegbulem (2007) employed combination discs method using ceftazidime and cefotaxime for analyzing ESBL production by E. coli isolated from commercial chickens in Enugu State, Nigeria and showed 30.6 per cent and 36.5 per cent of them as ESBL producers, respectively.

Table 2: Results of Novel disk placement method

Isolate No. Cx CTX CAC CAZ AT Ci Resistance Pattern
1 21 28 30 25 27 26
2 23 28 27 24 27 26
3 21 30 27 25 25 29
4 22 27 28 21 21 24 1
5 20 28 27 24 26 24
6 18 28 27 24 27 25
7 18 26 23 19 22 25 1
8 19 24 27 19 24 24 1
9 17 25 24 22 22 22 1
10 13 16 16 16 17 17 2
11 16 25 23 21 22 15 1
12 17 26 26 23 23 27
13 21 27 26 21 22 21 1
14 18 24 27 22 22 23
15 15 21 27 23 24 22
16 14 26 25 19 24 22 1
17 22 27 27 20 22 22 1
18 20 26 26 21 21 23 1
19 24 22 23 21 22 22 1
20 13 23 16 16 23 16 2
21 18 26 26 21 21 23 1
22 19 28 26 20 22 23 1
23 17 29 26 24 25 24
24 20 27 25 22 24 24
25 21 27 23 22 25 26
26 17 27 23 27 23 25
27 21 27 26 24 21 27
28 20 27 29 22 26 23 1
29 20 26 26 25 25 23
30 19 29 27 24 25 23
31 20 30 27 22 25 25 1
32 22 29 26 24 22 27

 1 ESBL ≤27mm Cefotaxime(CTX) ; ≤ 27mm Aztreonam(Az) ; ≤ 22mm Ceftazidime(CAZ);  ≤25 mm Ceftriaxone (Ci) ; Sensitive  to Cefoxitin (Cx) ; Increase in zone size  by 5mm or more with addition of  Ceftazidimelavulunic acid.

 2Amp C    Derepressed mutants (DM): Resistant to Cefoxitin and Cefotaxime. No increase in zone size with addition of inhibitor

 

 

 

This study could not identify the presence of three types of ESBL gene families (TEM, SHV or CTX M) from healthy poultry intestinal E. coli isolates and have not employed genotypic confirmation of AmpC derepressed mutants. Similarly, Samantha et al. (2015) isolated 272 E. coli strains from 360 backyard poultry from the four agro-climatic zones of West Bengal, India (Terai, New Alluvial, Coastal, Red Laterite soils) and showed that none of the E. coli isolates from the backyard poultry and farmed poultry in costal and red laterite soil were positive for any studied ESBL gene by PCR whereas 29.4 per cent of E. coli isolates from the farmed poultry in terai and new alluvial zones were found to possess the ESBL genes. The study conducted by Garcia-Graells et al. (2013) on a subset of E. coli isolates from poultry recorded 82.45 per cent and 17.55 per cent of them were positive for ESBL and AmpC genes, respectively. The same study showed the most predominant family found in commensal E. coli were CTX-M (ESBL) and CMY (AmpC), respectively.

All the isolates subjected for slime production by Modified Congo Red Agar (MRCA) method in this study were found highly positive (100 per cent). Skyberg et al. (2007) assessed biofilm production in 96-well microtitre plates of Avian E. coli using three different media and concluded that isolates are highly variable in their ability to form biofilms, however, most (75.7 per cent avian Faecal E. coli (AFEC) and 55.2 per cent Avian Pathogenic E. coli (APEC) were able to form a moderate or strong biofilm in at least one medium. A study conducted by Ahmad et al. (2008) in Pakistan commercial poultry farms attempted to isolate E. coli from water samples and subjected them to acridine orange direct count and viable count of E. coli indicated that 96 per cent of poultry farms in Pakistan have biofilm problem. E. coli count of these samples has shown that biofilm is one of major cause that produce colibacillosis at these poultry farms due to lack of management. This study could not correlate phenotypic results from genotypic results for the presence of ESBL genes. Because at present most of the studies from poultry have isolated E. coli from either caecal sample, cloacal sample, faecal swab and diseased condition for the demonstration of ESBL/AmpC production whereas this study aimed at demonstration of ESBL from healthy intestinal E. coli isolates. Moreover, Emmanuel et al. (2013) showed that ESBL production by E. coli isolated from cloacal swab samples (74 per cent) were high when compared to faecal samples (67 per cent) collected from the same poultry. Different strains of E. coli in the same poultry with different resistance types (ESBL and AmpC genes) were also recorded by Garcia-Graells et al. (2013).

Moreover, there could be involvement of other plasmid-mediated ESBLs such as OXA, CEP-1 and others (Jacoby and Sutton, 1985). Similarly, Reich et al. (2013) could not demonstrate AmpC genes in some phenotype-confirmed isolates which might indicate a different mechanism of resistance, probably attributable to overexpression of chromosomal AmpC, which usually results from mutations in the promoter/attenuator region. The poultry industry is one of the largest and fastest growing agro-based industries in the world (Haque et al., 2012).  India is a vast geographical country with different climatic zones and soil types.  As indicated earlier the study should be conducted from wide geographical area with continuous monitoring. Data on antibiotic usage in the different farms before sample collection would provide more information. The sample collection should be at farm level at different stages of poultry production and after slaughter from meat would provide more insight into the prevalence of ESBL E. coli from India. But in this study samples were limited to intestinal contents from birds at slaughter without much knowledge on antibiotic usage from the farm where the birds might have originated. As discussed earlier, there is a need for sample collection from different sites of same poultry for the detection of ESBL producing E. coli. As phenotypically some isolates were positive for ESBL/AmpC along with biofilm formation, it indicates that there lies a potential possibility of E. coli entering food supply either from farm premises directly or during slaughter by contamination of intestinal contents. The monitoring of resistance genes in the food supply chain should always be continuously monitored along with the isolates from the humans who are in close contact during farm activities and slaughter so that molecular epidemiology and phylogenetic analysis may be carried out to find out the probable source of origin for contamination and keep the rise of antibiotic resistant isolates in control throughout the food chain.

Conclusion

This study recorded 44 per cent of the E. coli isolated from healthy chicken intestines were ESBL producers and 6.3 per cent were derepressed mutants. All the isolates obtained from this study were slime producers. None of them harboured three genes of interest CTX-MSHV and TEM. This study shows the importance of regular monitoring of ESBL producing E. coli entry into food chain from farm premises or during slaughter to control emergence and spread of ESBL producing E. coli isolates from Poultry sector which is of high public health significance.

Acknowledgement

Authors extend their thanks to M/S.Subra Scientific Company, Puducherry for sponsoring this project.

Reference

  1. Ahmad S, Ashraf M, Siddique F, Mehmood M, Arshad and Khan HA.2008 Biofilm formation and drinking water quality in relation to Escherichia coli at commercial poultry farms. Journal of Agriculture and Social Science. 4: 77–80
  2. Babic M, Hujer AM and Bonomo RA. 2006 What’s new in antibiotic resistance? Focus on beta-lactamases. Drug Resistance Update 9:142-156.
  3. Bonnet R. 2004. Growing group of extended spectrum: the CTX-M enzymes. Antimicrobial Agents Chemotheraphy. 48:1-14.
  4. Chah KF and Oboegbulem SI. 2007. Extended-spectrum beta-lactamase production among ampicillin-resistantEscherichia coli strains from chicken in Enugu State, Nigeria Brazilian Journal of Microbiology 38:681-686
  5. Cheesbrough M.1984. Medical laboratory Manual for Tropical Countries Vol. II Microbiology. Cambridge University Press, Uk 586-589.
  6. Edelstein I and Stratchounnski L.2003. Prevalence and Molecular Epidemiology of CTX-M extended-spectrum betalactamase producing E.coli and K.pneumoniae in Russian hospitals. Antimicrobial Agents Chemotheraphy, 47, 3724-32
  7. Emmanuel E, Emmanuel N, Anthonia O, Chika E and Ieanyichukwu. I.2013. Microbiological investigation of Escherichia coli isolates from cloacal and feacal swabs of broiler chickens for extended spectrum beta lactamase (ESBL) enzymes International Journal of Pharmacy and Biological Sciences.7(5): 96-99
  8. Garcia-Graells C, Botteldoorn N and Dierick K.2013. Microbial surveillance of ESBL coli in poultry Meat, a possible vehicle for transfer of antiMicrobial resistance to humans Food: consumer protection. Scientific Institute of Public Health (WIV-ISP), Brussels, Belgium
  9. Haque N , Hossain SKA, Kumar M , Vijay Kumar and Tyagi AK.2012. Phytase – Their Biochemistry, Physiology And Application In Poultry International Journal of Livestock Research. 2(2):30-41
  10. Jacoby GA and Sutton L.1985. P-Lactamases and p-lactam resistance in E. coli. Antimicrobial Agents and Chemotherapy 28, 703-705.
  11. Jacoby GA.2006.β-lactamase nomenclature. Antimicrobial Agents and Chemotherapy 50:1123–1129
  12. Kim J, Jeon S, Lee B, Park M, Lee H, Lee J and Kim S .2009. Rapid detection of extended spectrum β-lactamase (ESBL) for Enterobacteriaceae by use of a multiplex PCR-based method. Infection and Chemotherapy 41 (3): 181–184
  13. Livermore DM.1995. Beta-lactamases in laboratory and clinical resistance.  Clinical Microbiology Review. 8:557-584.
  14. Machado E, Coque TM, Canton R, Novais A, Sousa JC, Baquero and Peixe L on behalf of the Portuguese resistance Study Group. 2007. High diversity of extended -spectrum beta-lactamases among clinical isolates of Enterobacteriaceae from Portugal. Journal of  Antimicrobial Chemotheraphy.70,1370-4
  15. Mariana NS, Salman SA, Neela V and Zamberi S. 2009. Evaluation of modified Congo red agar for detection of biofilm produced by clinical isolates of methicillin- esistanceStaphylococcus aureus. African Journal of Microbiological Research. 3 (6):330–338
  16. McPeake SJ, Smyth JA and Ball HJ .2005. Characterisation of avian pathogenic Escherichia coli (APEC) associated with colisepticaemia compared to faecal isolates from healthy birds. Veterinary Microbiology. 110, 245253.
  17. Nagdeo NV, Kaore NM and Thombare VR. 2012: Phenotypic methods for detection of various β-lactamases in Gram-negative clinical isolates: Need of the hour. Chronicles of Young Scientists. 3:292-8.
  18. Reich F, Atanassova V and Klein G.2013.Extended-Spectrum β-Lactamase– and AmpC-Producing Enterobacteria in Healthy Broiler Chickens, Germany. Emerging Infectious Diseases.19(8): 1253–1259.
  19. Rodrigues C, Joshi P, Jani SH, Alphonse M, Radhakrishnan R and Mehta A.2004 Detection of β-lactamases in nosocomial gram negative clinical isolates. Indian Journal of Medical Microbiology. 22: 247–250
  20. Samanta I, Joardar SN, Das PK and Sar TK.2015. Comparative possession of shiga toxin, intimin, enterohaemolysin and major extended spectrum beta lactamase genes in E. coli isolated from backyard and farmed poultry in West Bengal, India. Iranian Journal of Veterinary Research. 16(1): 90-93
  21. Skyberg JA,Siek KEDoetkott C and Nolan LK. Biofilm formation by avian Escherichia coli in relation to media, source and phylogeny. Journal of Applied. Microbiology. 102 (2):548-54.
Abstract Read : 451 Downloads : 90
Previous Next
Close