Introduction

Trypanosoma evansi (T. evansi) causes a disease known as surra in numerous mammalian hosts in many parts of the world including Africa, Asia, and South and Central America. In India, T. evansi infections are widely prevalent in most of the domestic animals including cattle, buffaloes, goats, sheep and pet animals including dogs and cats (Sivajothi et al., 2013; Reddy et al., 2016 ; Sivajothi and Reddy, 2018). Trypanosomes are motile possessing a single flagellum that contains the classic 9+2 axoneme (Hutchings et al., 2002). Despite the appearance of this highly conserved structure less is known about its proteomic composition and mechanical function. The trypanosome flagellum contains up to 600 proteins (Broadhead et al., 2006; Subota et al., 2014). The paraflagellar rod (PFR) is an additional structure found in Trypanosoma spp. Paraflagellar rod protein components are distinct in nature both structurally and immunologically and they are different from any human and animal proteins. The molecular biology techniques such as reverse transcriptase – polymerase chain reaction (RT-PCR) has proven to be rapid and reliable for the detection of different pathogenic components. The present study is under taken with an aim to standardize the specific RT-PCR for detection and amplification of a conserved region (PFR 2) of the Trypanosoma evansi infecting domestic livestock in South India.

Materials and Methods

Propagation and Purification of Trypanosoma evansi

Isolates of Trypanosoma evansi was collected from the clinically affected cattle and T. evansi organism were inoculated through intra-peritoneal route in to Wistar rats and maintained for bulk harvest of parasites. High parasitaemia was assessed by examination of the blood smears and the blood was collected for separation and purification of Trypanosoma evansi parasites by Diethyl amino–ethyl cellulose anion exchange column chromatography (DEAE). The eluted parasites were pelleted by centrifugation at 2400 x g for 30 minutes at 4ºC and stored at -20^º C until further use (Sivajothi et al., 2013).

Extraction of RNA from Host Cell Free Trypanosoma evansi Parasites

Total RNA was extracted directly from the host cell-free trypanosomes by using Trizol reagent (Invitrogen, CA, U.S.A). Briefly, 1 ml of the host cell free T. evansi parasites was transferred to sterile RNase free 2 ml microfuge tube and centrifuged at 13,200 rpm for 10 min. The supernatant was removed by aspiration. The pellet was dissolved in 750 µl of the Trizol reagent by vortex for 1minute and incubated for 10 min at room temperature. Two fifty micro liters of the chloroform was added to the lysates followed by vortex for 1 min, kept at room temperature for 10 min and centrifuged at 13,200 rpm for 15 min. The clear aqueous phase was collected in to the fresh RNase free microfuge tube and equal volume of isopropanol was added, mixed thoroughly by inverting the tubes and kept at room temperature for 30 min. The   nucleic acid was pelleted down by centrifugation at 13,200 rpm for 20 min and washed with 70% ethanol by centrifugation at 13,200 rpm for 5 min. The pellet was air dried and dissolved in 30 µl of the RNase free water and stored at -20^ºC until use.

Determination of Concentration and Purity of RNA

ELUTED RNA of Trypanosoma evansi was tested for its concentration and purity with Nanodrop^®. The purity of the RNA was estimated by observing the ratio between optical density value at 260 nm and 280 nm. RNA samples were considered to be of sufficient purity if the ratio was 2.0. The eluted RNA samples were stored at -80^ºC for further use.

Preparation of Complementary DNA (cDNA)

Reverse transcription was performed to get Complimentary DNA (cDNA) from the total RNA. Reverse transcription was carried out in a 20 µl reaction volume by using Revert Aid ^TM H minus first strand cDNA synthesis kit (Thermo Scientific, USA). cDNA synthesis was carried out as per manufacturer’s instruction. Template RNA (3.0 µl), Oligo dT primers (1.0 µl) and Nuclease free water (9.0 µl) were added and this mixture was incubated at 65^ºC for 5 minutes and placed immediately on ice. Finally, a 20 µl reaction mixture was prepared by adding 4.0 µl of 5X Reaction Buffer, 1.0 µl of Ribolock RNase Inhibitor, 2.0 µl of 10 mM dNTP Mix and 1.0 µl of M-MuLV Reverse Transcriptase. Reaction was carried out in a thermal cycler (Corbett Research, Model CG1-96, Australia) using the incubation conditions as 42oC for 60 minutes and 72^ºC for 10 Minutes. The synthesized cDNA was stored at -20^ºC until use.

Polymerase Chain Reaction

Polymerase chain reaction (PCR) amplification was carried out in 20 μL of reaction volume containing cDNA, forward primer, reverse primer. MgCl₂ (Fermentas, USA Taq deoxyribonucleic acid (DNA) polymerase (Fermentas, USA), dNTPs (Fermentas, USA) and nuclease free water.  The reaction was carried out using gradient thermal cycler (Corbett Research, Model CG1-96, Australia) and the PCR products along with the marker DNA (1 kb DNA ladder, Fermentas, Canada) were electrophoresed in 1% agarose gel in 0.5X Tris Borate EDTA (TBE) buffer as per the method of Sambrook and Russel (2001) using horizontal submarine electrophoresis (Bangalore Genie, India) and stained with ethidium bromide (0.5 µg/ml). The gel was examined on UV transilluminator (Alpha Innotech, USA) and photographed.

Purification of PCR Product of PFR 2 Gene of Trypanosoma evansi

The Trypanosoma evansi PFR 2 gene PCR amplicon was gel purified from the LMP agarose using QIAquick Gel Extraction Kit (QIAGEN Inc. USA).  The purified amplicons were further checked by electrophoresis in 1% agarose gel. Concentration of the purified PCR amplicon of PFR 2 gene of T. evansi was measured with Nanodrop^®.

The reverse transcription was used to produce the cDNA with the extracted RNA from host cell free trypanosomes using the oligo dT primers. RT enzyme M-MLV enzyme was used and the amplified cDNA was preserved at -20°C. The PCR amplification of PFR 2 gene of T. evansi was found to be optimum at a final concentration of 2.0 mM MgCl ₂, 2.5 U Tag polymerase,  0.2  mM of each dNTPs and 10 pmoles of forward primer (SSJ-F:5′- GGAATTCATGAGCGGGAAAGGAAGTTGAAG 3′), 10 pmol of reverse primer (SSJ-R 5′- CCCAAGCTTCTGAGTGATCTGCGGCATCGTG -3′) in the reaction mixture of 20 µl volume. The cycling conditions were optimized as initial denaturation temperature of 94°C for 3 min, followed by 35 cycles of denaturation at 94°C for 30 sec, primer annealing at 60°C for 45 sec, extension at 72°C for 1 min with a final extension at 72°C for 15 min.

Results and Discussion

The blood smear made from naturally infected cattle blood and stained by Giemsa stain revealed the presence of Trypanosoma evansi parasites (Fig. 1).

Fig.1: Presence of Trypanosoma evansi in the peripheral blood of cattle (Stained by Giemsa stain, 1000X).

Trypanosoma evansi parasites were separated from blood of infected rats by using DEAE-cellulose column chromatography. Purified trypanosomes with detailed morphological structures such as centrally placed nucleus, sub-terminal kinetoplast, well developed undulating membrane and flagellum are seen (Fig. 2).

Fig.2:  Purified Trypanosoma evansi parasites by DEAE cellulose colmn chromatography (Stained by Leishman’s stain, 1000X)

Concentration of total RNA and the purity range was estimated in between 100. 50 -120.60 n/µl and 1.8 – 2.0, respectively. The Trypanosoma evansi PFR2 gene (1800 bp in length nucleotide length) was amplified with earlier amplified cDNA from RT. The PCR method standardized was found suitable for specific amplification of PFR 2 of T. evansi cDNA. This amplified PCR product was checked in agarose gel and a single band of 1800 bp was observed and compared against 1kb ladder (Fermants) (Fig. 3). Concentration of the purified PCR amplicon of PFR 2 gene of T. evansi was 40 ng/µl.

Fig.3: RT-PCR amplification of PFR 2 gene of Trypanosoma evansi.

Surra causes significant economic loss due to high degree of morbidity associated with decreased production and mortality of animals (Reddy et al., 2016). Chemotherapy is the modest success in control of surra in animals in spite of high cost of therapeutic regimens and drug resistance against T. evansi (Sivajothi and Reddy, 2016). Development of vaccine against surra appears remote because of the ability of T. evansi to evade the host immune system by antigenic variation (Pays, 2006). PFR is immunogenic and highly conserved protein and can be used as vaccine candidate and diagnostic antigen (Abdille et al., 2008). Therefore a sensitive, specific, and more rapid means of detection of such conserved protein is desirable.

Trypanosome flagellum contains an extra-axonemal paraflagellar rod which is important for trypanosome motility (Bastin et al., 2000). The paraflagellar rod is composed of PFR 1 and PFR 2 proteins. These proteins are found in all other kinetoplastids with a paraflagellar rod. PFR1 and PFR 2 are well conserved between species and isolates with only the ends showing significant diversity. This non-variable immunogenic antigen could be useful for detecting infection with pathogenic trypanosomes and vaccine production. Several methods have been developed for the detection of PFR components of T. evansi infection but among these, RT-PCR is considered to be the most sensitive and specific and it has a wider range of application (Reid, 2002). Cloning and expression of paraflagellar rod protein of Trypanosoma evansi was done by the previous authors and they isolated the similar type of protein from the camel isolates (Maharana et al., 2011; Sanjay Kumar et al., 2013). The RT-PCR conditions standardized in the present study were quite different than those reported earlier. The present study highlighted the standardization of RT-PCR to detect the existence of PFR 2 gene in the local strain of Trypanosoma evansi collected from the cattle.

Conclusion

Reverse transcriptase – polymerase chain reaction was standardized for the detection of Paraflagellar rod 2 gene of Trypanosoma evansi collected from the blood of cattle in Andhra Pradesh (South India). The optimal RT-PCR conditions to amplify the conserved 5’ PFR 2 gene of Trypanosoma evansi are the use of 3µL of 20 ng/µL RNA concentration with the cycling conditions of 94°C for 3 min, followed by 35 cycles of denaturation at 94°C for 30 sec, primer annealing at 60°C for 45 sec and extension at 72°C for 1 min with a final extension at 72°C for 15 min.  The optimized amplification of PFR 2 gene of Trypanosoma evansi resulted in 1800 bp band.

Author’s Contribution and Competing Interests

Authors declare that they have no competing interests.

Author’s Contribution

This is part of PhD research work of first author; second, third, fourth, fifth authors are advisory committee for the PhD programme and last author provided the financial support for completion of the PhD research work.

Acknowledgement

Authors expressed sincere thanks to the authorities of Sri Venkateswara Veterinary University, Sri Venkateswara University and RARS, Tirupati for providing necessary facilities to carry out this work.

References

1. Abdille MH, Li SY, Suo X, Mkoji G (2008) Evidence for the existence of paraflagellar rod protein 2 gene in Trypanosoma evansi and its conservation among other kinetoplastid parasites. Exp Parasitol 118: 614-618.
2. Bastin P, Pullen TJ, Moreira-Leite FF, Gull K (2000) Inside and outside of the trypanosome flagellum: A multifunctional organelle. Microbes and Van Nieuwenhove, infection / Institut Pasteur, 2(15):1865-1874.
3. Broadhead R, Dawe HR, Farr H, Griffiths S, Hart SR (2006) Flagellar motility is required for the viability of the blood stream trypanosome. Nature 440: 224–227.
4. Hutchings N R, Donelson JE,  Hill KL (2002) Trypanin is a cytoskeletal linker protein and is required for cell motility in African trypanosomes.  J  Cell Biol 156(5), 867-877.
5. Maharana BR, Rao JR, Tewari AK, Singh H (2011) Cloning and expression of paraflagellar rod protein (PFR 2) gene of Trypanosoma evansi. J Vet Parasitol 25(2): 118-123.
6. Pays, E (2006). The variant surface glycoprotein as a tool for adaptation in African trypanosomes. Microbes Infect 8: 930–937.
7. Reddy BS, Kumari KN, Sivajothi S, Rayulu VC (2016) Haemato-biochemical and thyroxin status in Trypanosoma evansi infected dogs, J Parasit Dis, 40:491-495, DOI 10.1007/s12639-014-0531-6.
8. Reid SA (2002) Trypanosoma evansi control and containment in Australasia. Trends Parasitol 18, 219-223.
9. Sambrook J Russel DW (2001) Molecular cloning: A laboratory manual 3rd ed. Cold Spring Harbor LaboratoryPress, Cold spring Harbor, NY.
10. Sanjay kumar GS, Manohar SK, Ghorui1 SK, Kashyap S, Maherchandani, NV Patil (2013) Amplification, cloning and sequence analysis of paraflagellar rod 2 gene of Trypanosoma evansi isolated from Indian dromedaries. Vet Pract 14 (2) : 204-207.
11. Sivajothi S, Rayulu VC, Malakondaiah P, Sreenivasulu D (2013) Colloidal dye immunobinding assay for detection of Trypanosoma evansi antibodies in animals. Int J of Livest Res 3(3):48–56
12. Sivajothi S, Reddy BS (2016) Polypeptide profiles of diminazene aceturate resistant Trypanosoma evansi organisms isolated from a buffalo. J Veter Sci Med, 4(1): 1.
13. Sivajothi S, Reddy BS (2017) Antioxidant status and electrocardiographic changes in buffaloes with Trypanosoma evansi infection, Chem Sci Rev Lett 2017, 6(24), 2573-2576. Article CS092048114.
14. Sivajothi S, Reddy BS (2018) Trypanosoma evansi infection in a cat – a rare case, Comp Clin Pathol, 27:115–116. DOI 10.1007/s00580-017-2560-x.
15. Subota I, Julkowska D, Vincensini L, Reeg N, Buisson J (2014) Proteomic analysis of intact flagella of procyclic Trypanosoma brucei cells identifies novel flagellar proteins with unique sublocalisation and dynamics. Mol Cell Proteomics 033357.