NAAS Score 2020

                   5.36

UserOnline

Free counters!

Previous Next

Staphylococcus Aureus Elicit an Increased Expression of TLR9 Gene to the Innate Immune Response in Bovine Mastitis

R. Lakshmi K.K. Jayavardhanan J. Thanislass
Vol 7(8), 167-172
DOI- http://dx.doi.org/10.5455/ijlr.20170610050638

Mastitis in dairy cattle caused by S. aureus infection may eventually turn into a chronic disease with a lifelong persistence of the bacteria. TLR9 plays a crucial role in cell survival through recognition of various bacterial components. This study was carried out to assess the expression of TLR9 gene in spontaneous bovine sub-clinical and clinical mastitis caused by S. aureus. RNA isolated from milk somatic cells was converted as cDNA using oligo (dT) primers. Quantitation of mRNA of TLR9 was analysed by RT-qPCR system. The mRNA expression of TLR9 gene in sub-clinical mastitis was higher (3.71 fold) than clinical case (1.15 fold) when compared to normal bovine case. The expression of TLR9 gene at high level during sub-clinical stage of infection, may be subsided itself without precipitating into clinical mastitis. The results presented would facilitate deeper insight into the specific regulatory mechanisms of TLR9 mediated signalling cascades to elucidate host immune response against bovine mastitis.


Keywords : Mastitis Immune TLR9 Expression S. aureus

Introduction

Mastitis in dairy cattle is the persistent, inflammatory reaction of the udder tissue. This inflammatory mammary gland of the infection is always caused by both Gram-positive and negative bacteria (Hogan and Smith, 2003). Mastitis caused by S. aureus is mostly less severe but can eventually turn into a chronic infection with a lifelong persistence of the bacteria (Riollet et al., 2000; Yang et al., 2008). The innate immune response is the principle line of defence during the initial stage of infection and is induced rapidly at the site of infection (Sordillo et al., 1997). Toll-like receptors (TLR) are the best-described innate receptors and comprise of functional molecule that provide critical host defence during bacterial infection (Lemaitre et al., 1997). TLR9 is a pattern-recognition receptor present inside the cells, involved in immune signalling and plays a crucial role in cell survival through recognition of various bacterial components. TLR9 has been demonstrated as a receptor for bacterial DNA containing a specific sequence pattern including unmethylated CpG dinucleotides (Hemmi et al., 2000). Specifically, TLR9 as pattern recognition receptors has been implicated as a link between the innate and adaptive immune system by favouring immune response and enhancing auto-antibody production (Tanaka et al., 2010). Hence, this study was carried out to assess the comparative expression levels of TLR9, in sub-clinical and clinical mastitis caused by S. aureus infection.

Materials and Methods

Sample Collection and Identification of S. aureus

Eighty raw milk samples were collected from University farm and Veterinary Dispensaries at Mannuthy, Kerala, and the samples were categorized into three groups sub-clinical, clinical and normal based on California mastitis test (CMT) and somatic cell count (SCC). The milk samples were streaked on Muller Hinton agar plates for identification of genus level of Staphylococcus. The positive cultures were further subjected to biochemical tests for identification of species specific S. aureus (Quinn et al., 2002). From each group three samples were selected for further study.

RNA Isolation and cDNA Synthesis

Total RNA extraction was carried out from milk somatic cells with the TRIzol reagent of SIGMA (As per the manufacturer’s protocol). The quality of extracted RNA was assessed by electrophoretically using 0.8 per cent agarose (Invitrogen) gel in a horizontal submarine electrophoresis unit. The concentration of isolated RNA was assessed by using nanodrop spectrophotometer. Complementary DNA was synthesized from total RNA by using RevertAid first strand cDNA synthesis kit by using oligo dT primers (Thermo Scientific, K1622).

Primers Design and Synthesis

Primers for RT-qPCR of TLR9 and β-actin were designed from published bovine mRNA sequences available from NCBI GenBank. Designing and checking of primers were done with Primer3 software (Table 1).

Table 1: Primer sequence for TLR9 and β-actin genes used in RT-qPCR

Gene Name Sequence (5’→3′) Expected Product Size
TLR9 F AAGGCTTGAGGAACCTGGTC 119 bp
R GTTATTGTCCCGGAGACGCA
β-actin F CCACACCTTCTACAACGAGC 105 bp
R ATCTGGGTCATCTTCTCACG

RT-qPCR

The RT-qPCR amplification of TLR9 gene was performed by using the Illumina Eco® Q- RT PCR system. The β-actin was used as housekeeping gene because it showed a stable expression from all milk samples. A reaction solution was prepared on ice, a total volume 20 microlitre consists of 10 microlitre of 2X SYBR Green PCR master mix, 10 pmole 1microlitre) of each gene-specific primers, 2 microlitre of cDNA template and 7 microlitre of nuclease free water. All reactions were performed as triplicates. Real time PCR cyclic conditions were 95ºC for 10 min then 40 cycles of 95 ºC for 30 sec, 58ºC for 30 sec and 72 ºC for 1 min with fluorescence recording at the end of each cycle. After 40 cycles, dissociation curve analysis PCR products to determine the specificity of the amplicons. The gene expression levels were analyzed with the 2-ΔΔCT method (Kumar et al., 2012). All the statistical analyses were done using SPSS version 21.0 software.

Results and Discussion

Mastitis is the persistent inflammatory condition of udder tissue and fatal mammary gland infection in dairy cattle. The first line of defense against mammary bacterial infection was initiated by innate resistance of mammary gland. It has the ability to recognize and respond instantly to the earlier signs of infection. Soon after the entry of invading bacteria, the leukocytes and epithelial cells pledge the inflammatory response essential to eradicate the invading pathogen. Mastitis caused by S. aureus, is characterized by moderate and delayed increase of SCC (Yoshimura et al., 1999). Innate resistance of mammary gland is one of the first line of host defense against mammary bacterial infection Hence, assessing the comparative expression pattern of TLR9 in somatic cells of milk during sub-clinical and clinical mastitis caused by S. aureus may help to monitor their involvement in mammary innate resistance and subsequent use of this information will be validated as markers.

Crossbred bovines were screened for sub-clinical and clinical mastitis using CMT. Biochemical and microbiological screening identified positive sub-clinical and clinical samples for S. aureus. Based on the screening for S. aureus, three animals were selected from each group of sub-clinical and clinical mastitis. In addition milk samples from apparently healthy crossbred cows were also selected as control for expression studies. Analysis of variance for TLR9 gene revealed significant deference (P ≤ 0.01) for expression level between the groups (Table 2).

Table 2: ANOVA for TLR9 gene expression in S. aureus caused mastitis

Source of Variation df MSS F value
Between Groups 2 7.00** 95.64
Within Groups 6 0.07

The mean values of Cq, ∆Cq, ∆∆Cq along with standard error and relative quantification of TLR9expression in S. aureus caused mastitis are given in Table 3.

Table 3: Expression of TLR9 gene in S. aureus caused sub-clinical and clinical mastitis

a = Normal vs Sub-clinical; b = Normal vs Clinical; c = Sub-clinical vs Clinical

Relative expression of TLR9 gene varied from 3.27 to 4.04 fold increase in sub-clinical mastitis cases caused by S. aures with a mean of 3.71 fold, as compared to normal. In case of clinical mastitis, relative expression of TLR9 varied between 1.01 to 1.44 with a mean of 1.15 fold, when compared with healthy (normal) cows (Fig.1). The relative expression of TLR9 in S. aureus affected samples was considerably high (3.71 fold up) in sub-clinical mastitis affected cattle in comparison with healthy crossbred but difference was non-significant. This finding is in contradiction to Goldammer et al. (2004). In their study the level of TLR9 expression in mastitis caused by S. aureus was almost similar to those in the controls. Whereas, Mitra et al. (2014) showed up-regulation of TLR9 mRNA in mice challenged with S. aureus. These results disclose the vital role of TLR9 in early innate immune response in udder against mastitis.

Fig. 1: Frequency distribution of TLR9 gene expression in S.aureus caused mastitis (N – Normal healthy; SC – Sub-clinical mastitis; C – Clinical mastitis)

During early stage of infection TLR9 was expressed at high level to defend against pathogens, hence most of the sub-clinical mastitis may subsided by itself without precipitating into clinical mastitis. Hence, TLR9 might play an essential role in immune response against bovine mastitis by ligand recognition and signal transduction. The results presented would facilitate deeper insight into the specific regulatory mechanisms of TLR9 mediated signalling cascades to elucidate host immune response against bovine mastitis.

Conclusion

During early stage of S. aureus infection TLR9 was expressed at high level to defend against pathogens, hence most of the sub-clinical mastitis may subsided by itself without precipitating into clinical mastitis. Hence, TLR9 might play an essential role in immune response against bovine mastitis caused by S. aureus.

Acknowledgments

The first author acknowledging the INSPIRE Fellowship program of Department of Science and Technology for providing fellowship for the PhD program. The authors are thankful to the Dean, College of Veterinary and Animal Science for providing facilities to conduct this experiment.

References

  1. Goldammer T, Zerbe H, Molenaar A, Schuberth HJ, Brunner RM, Kata SR and Seyfert HM. 2004. Mastitis increases mammary mRNA abundance of β -Defensin 5, Toll-like-receptor 2 (TLR2) and TLR4 but not TLR9 in cattle. Clin. Diag. Lab. Immunol. 11: 174-185.
  2. Hogan J and Smith KL. 2003. Coliform mastitis. Vet. Res. 34: 507-519.
  3. Kumar R, Tiwari AK, Chaturvedi U, Kumar GR, Sahoo, A. P., Rajmani, R. S., Saxena, L., Saxena S, Tiwari S and Kumar S. 2012. Velogenic newcastle disease virus. Appl Biochem Biotechnol. 167: 2005-2022.
  4. Lemaitre B, Reichhart JM and Hoffman JA. 1997. Drosophila host defense: Differential induction of antimicrobial peptide genes after infection by various classes of microorganisms. Proc. Natl. Acad. Sci. USA. 94: 14614-14619.
  5. Mitra SD, Ghosh SH, Krishnamoorthy P, Chakraborty A, Venugopal NC, Roy M, Shome BR and Rahman H. 2014. Characterization of TLR expression in Staphylococcus aureus induced mastitis in mice model by probe based real time PCR. Indian J. Anim. Sci. 84: 1043-1047.
  6. Quinn PM, Carter B, Markey and Carter G. 2002. Clinical veterinary micro biology mos by international Ltd, Spain and, pp: 96-344.
  7. Riollet C, Rainard P and Poutrel B. 2000. Cells and cytokines in inflammatory secretions of bovine mammary gland. Adv. Exp. Med. Biol. 480: 247-158
  8. Sordillo LM, Shafer-Weaver K and DeRosa D. 1997. Immunobiology of the mammary gland. J. Dairy Sci. 80: 1851-1865.
  9. Tanaka J, Sugimoto K, Shiraki K, Tameda M, Kusagawa S, Nojiri K, Beppu T, Yoneda K, Yamamoto N, Uchida K, Kojima T and Takei Y. 2010. Functional cell surface expression of Toll-like receptor 9 promotes cell proliferation and survival in human hepatocellular carcinomas. International Journal of Oncology 37: 805–14.
  10. Yang W, Zerbe H, Petzl W, Brunner RM, Gunther J, Draing C, Aulock VS, Schuberth HJ and Seyfert HM. 2008. Bovine TLR2 and TLR4 properly transduce signals from Staphylococcus aureus and E. coli, but S. aureus fails to both activate NF-kappaB in mammary epithelial cells and to quickly induce TNF alpha and interleukin-8 (CXCL8) expression in the udder. Mol. Immunol. 45: 1385-1397.
  11. Yoshimura A, Lien E, Ingalls RR, Tuomanen EI, Dziarski R and Golenbock D. 1999. Recognition of Gram-positive bacterial cell wall components by the innate immune system occurs via Toll-like receptor 2. J. Immunol. 163: 1-5.
Full Text Read : 1670 Downloads : 289
Previous Next

Open Access Policy

Close