Foot and mouth disease virus (FMDV) has a worldwide distribution and is of major importance for the animal industry in India (Chakraborty et al., 2014; Verma et al., 2012, 2017). The disease is particularly a problem for countries where animals and meat contribute significantly to the national economy through export markets. Foot and mouth disease (FMD) is enzootic in many parts of India (Singh et al., 2008; Verma et al., 2017). Therefore, rapid and accurate diagnosis of FMD is essential for the success of FMD control programme (Verma et al., 2008). A suitable and reliable test must be able to detect FMDV circulating in animal population, as well as a low number of viral particles. The reverse transcription polymerase chain reaction (RT-PCR) has been shown to be a useful tool in the diagnosis of FMD (Marquardt et al., 1995; Raies et al., 2009; Verma et al., 2010), as a part of the viral genome can be detected with a very high sensitivity in less than 24 h in a wide range of samples (Meyer et al., 1991). The detection of structural protein antigen of FMD by ELISA was shown to be rapid and simpler to perform (Ferris and Dawson, 1988) and considered as the primary test for FMD diagnosis in the regionally located FMD diagnostic laboratories in the country (Anon, 2010). In this study, RT-PCR was used for screening the vesicular epithelium samples collected from cattle and buffaloes from some districts of Uttar Pradesh state for the diagnosis of different serotypes of FMD virus.

Materials and Methods

Sample Collection                                                         

A total of 25 vesicular epithelia (tongue epithelium) samples were collected from 19 cattle and 6 buffaloes showing clinical signs viz. vesicle formation on the mucous membranes of the tongue, interdigital spaces, salivation, anorexia from different districts of Uttar Pradesh. These samples were preserved in 50% phosphate buffered saline (PBS) glycerol, pH 7.4 till further test.

Sandwich ELISA Test

The samples were tested by indirect sandwich ELISA (Bhattacharya et al., 1996).

Reverse Transcription Polymerase Chain Reaction (RT-PCR)

Total RNA was extracted from all the 25 samples (tongue epithelium) with the modification of the acid guanidium phenol-chloroform methods (Callens et al.,1998). Reverse transcription (RT) was carried out with 10 µl of RNA in 25µl of final reaction volume using MMLV reverse transcriptase and NK61 primer GACATGTCCTCCTGCATCTG (Knowles and Samuel, 1998). The reaction mixture was incubated at 48^oC for 1 h. Additional incubation at 95^oC for 5 min. was done to inactivate the enzyme. The PCR amplification of the entire VP1 genomic region from this cDNA was carried out using Hotstar PCR kit (Qiagen) and 20 pmol of each forward primer (Table 1) and NK61 reverse primer (Knowles and Samuel, 1998) as per the recommendations of the supplier.

Table 1: Primers used for amplification of FMDV

The thermal cycling condition employed for PCR amplification are shown in Table 2.

Table 2: Optimum PCR conditions for each primer sets

The PCR products (5 µl sample) were run on 1% agarose gel containing ethidium bromide and the DNA bands were visualized using a UV transilluminator.

Results and Discussion

Foot and mouth disease virus (FMDV) is the economically most important veterinary pathogen due to its highly infectious and contagious nature, ability to cause persistent infections and long term effects on the condition and productivity of the many animal species. Countries which have this disease have many trade restrictions placed upon them (Shanafelt and Perrings, 2018). FMD is endemic in India and occurs in all parts of country throughout the year. Rapid and accurate laboratory detection of FMDV plays a critical role in the implementation of control measures to eradicate FMD. In the present study, out of 25 vesicular epithelium samples (tongue epitheliums) collected from suspected cases of FMD, 17 were found positive for the presence of FMD virus by indirect sandwich ELISA. Several researchers from different countries have reported that sandwich ELISA is a good test in terms of sensitivity as well as specificity for serotyping of FMD virus (Alonso et al., 1992; Chomczynski et al., 1987; Mann et al., 1998; Ouldridge et al., 1987; Prasad et al., 1992; Verma et al., 2008). In the present study, the overall typeability was 68.00% using sandwich ELISA. The percentage was found comparable to international standards. The possible reasons for non-typing of virus from remaining samples may be either samples were not collected at the proper time of clinical manifestation of disease or were not suitably preserved (Pattnaik et al., 1990). All the 25 tongue epithelium samples were also processed by reverse transcription (RT) using random hexanucleotide primer, followed by the polymerase chain reaction (PCR) (Fig. 1).

Fig. 1: Agarose gel electrophoresis of 1301 bp and 865 bp PCR products amplified from FMDV

( M1: DNA marker 1 kb; L 1: Positive sample (Type O); L 2-L4: Negative sample; L 3: Negative sample;  L 4: Negative control;  L 5: Positive sample (Type A, UPl); L 6:   Positive sample (Type A, Brl); L 7: Negative sample; L 8: Positive sample (Type A); L 9: Negative control; M2: DNA marker 100 bp)

Out of 25 samples, amplicons could be amplified from 20 samples (12 serotype O and 8 serotype A) using RT-PCR. However, serotype ‘C’ and ‘Asia-1’ could not be recovered from these samples. In the scenario of overall distribution pattern of FMD virus types, serotype ‘O’ (60.00%) was the predominant type, followed by serotype ‘A’ (40.00%), (Table 3).

Table 3: Distribution results of FMD virus types by RT-PCR

Comparison of sandwich ELISA based typing and RT-PCR result revealed that 17 samples positive for FMDV by Sandwich ELISA were also positive with RT-PCR and amplicons of 1301 and 864 bp could be amplified. The known positive control RNA extract of FMDV also yielded similar amplicons. However 3 specimens negative in sandwich ELISA test were found to be positive in RT-PCR.It indicates that the RT-PCR is more sensitive than and sandwich ELISA test (Donn et al., 1996; Reid et al., 1999; Alexandersen et al., 2000; Paprocka and Kesy, 2001; Paprocka et al., 2002; Clavijo et al., 2003; King et al., 2006; Verma et al., 2010, 2012). The higher sensitivity of RT-PCR may be because of its ability to detect very small number of virus as well as detection of RNA of non-viable FMD virus. The detection of viral genome, rather than live virus or viral proteins, has the advantage that viable virus or intact viral antigen is not required. Where subclinical infection is suspected or when samples are collected before the appearance of clinical sign (Marquardt et al.,1995) or after the resolution of clinical disease or when processing saliva or swabs, an enhanced RT-PCR technique (Callens and DeClercq, 1997) produces a detection system as sensitive and considerably more rapid than multiple passages on tissue culture. Moreover, it saves time and labour, as it takes only approximately 5-6h.to identify the presence of FMD virus compared to 10-16h. taken by the sandwich ELISA. These findings indicate PCR assay as a simple, rapid, sensitive, reliable, reproducible and an additional confirmatory method for the identification of FMDV that will aid in surveillance, prevention and control of this pathogen.

Conclusion

The results of this study provided the valuable data regarding the occurrence of FMD in bovines from Uttar Pradesh, India. The findings further indicated PCR assay as a simple, rapid, sensitive, reliable, reproducible and an additional confirmatory method for the identification of FMDV. Such outcomes proves to be very useful for accurate diagnosis of FMD and therefore, strengthens the strategies for prevention and control of this disease.

Acknowledgement

The authors are thankful to the FMD Virus Typing Laboratory IVRI, Mukteshwar, Dean College of Veterinary and Animal Sciences and Vice-Chancellor, G. B. Pant University of Agriculture and Technology, Pantnagar and Regional Research Centre, AICRP on FMD, DUVASU, Mathura for the necessary help and the facilities provided during the study.

References

1. Alexandersen, S., Forsyth, M. A., Reid, S. M. and Belsham, G. J. (2000). Development of RT-PCR (Oligonucleotide probing) enzyme linked immunosorbent assays for diagnosis and preliminary typing of foot-and-mouth disease: A new system using simple and aqueous-phase hybridization. Clin. Microbiol. 38: 4604-4613.
2. (2010). Annual Reports. Project Directorate on Foot and Mouth Disease. Mukteswar: 263138 Nainital (Uttaranchal) Available from: http://www.icar.org.in/files/pdfmd-vacancy-t3-2010.pdf.
3. Callens M. and DeClercq K. (1997). Differentiation of the seven serotypes of FMDV by RT-PCR. Journal of Virological Methods. 67: 35-44.
4. Callens M., De Clercq, K., Gruia, M. and Danes, M. (1998). Subclinical FMD infection in contact sheep: detection of FMDV by RT-PCR-ELISA and transmission of the virus to sentinel pigs. Quarterly. 20(2): 37-40.
5. Chakraborty, S., Kumar, N., Dhama, K., Verma, A.K., Tiwari, R., Kumar, A., Kapoor, S. and Singh, S.V. (2014). Foot and mouth disease, an economically important disease of animals. Anim. Vet. Sci. 2(2S): 1-18.
6. Clavijo, A., Viera-Pereira, P. J. and Bergmann, I. (2003). Use of the reverse transcription polymerase chain reaction (RT-PCR) for the rapid diagnosis of foot-and-mouth disease in South America. Res. Commun. 27: 63-71.
7. Donn, A., Martin, L. A. and Donaldson, A. I. (1996). A method using the PCR for the demonstration of chronic infection of foot-and-mouth disease in experimentally infected cattle. Societa Italiana Di Buiatria. 1: 805-808.
8. Ferris, NP and Dawson M (1988). Routine application of enzyme-linked immunosorbent assay in comparison with complement fixation for the diagnosis of foot-and-mouth and swine vesicular diseases. Vet Microbiol. 16(3):201-209.
9. King, D. P., Ferris, N. P., Shaw, A. P., Reid, S. M., Hutchings, G. H., Giuffre, A. C., Robida, J. M., Callahan, J. D., Nelson, W. and Beckham, T. R. (2006). Detection of foot-and-mouth disease virus: Comparative diagnostic sensitivity of two independent real-time reverse transcription-polymerase chain reaction assays. Vet. Diagn. Invest. 18: 93-97.
10. Knowles, N. J. and Samuel, A. R. (1998). RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals, OIE/FAO World Reference Laboratory for Foot and Mouth disease.1-37.
11. Marquardt, O., Straub, O. C., Ahl, R. and Haas, B. (1995). Detection of foot and mouth disease virus in nasal swabs of asymptomatic cattle by RT-PCR within 24h. Virol. Methods, 53: 255-261.
12. Paprocka, G. and Kesy, A. (2001). Detection of foot-and-mouth disease virus in biological material. Medycyna Weterynaryjna. 57: 114-117.
13. Paprocka, G., Kesy, A., Niedbalski, W. and Fitzner, A. (2002). Detection and typing of foot-and-mouth disease virus isolates. Medycyna Weterynaryjna. 58: 699-702.
14. Pattnaik, B., Rai, D. V. and Venkataramanan, R. (1990). Characterization of type O FMD virus isolates recovered from outbreaks in India. Indian J. of Ani. Sc. 60(11): 1265-1270.
15. Raies, M., Verma, A.K., Yadav, S.K., Pal, C., Mahima and Jain, U. (2009) Genetic and antigenic relationship between foot and mouth disease virus serotype Asia-1 isolate and vaccine strain, Onl J Vet Res. 13 (2):114-119.
16. Reid, S. M., Hutchings, G. H., Ferris, N. P. and DeClercq, K. (1999). Diagnosis of foot-and-mouth disease by RT-PCR: Evaluation of primers for serotypic characterization of viral RNA in clinical samples. Virol. Methods. 83: 113-123.
17. Shanafelt, DW and Perrings C (2018). The Effect of the Post 2001 Reforms on FMD Risks of the International Live Animal Trade. Ecohealth. 15(2): 327–337.
18. Singh, C. P., Verma, A.K., Pal, B. C. (2008). Prevalence of Protected animals against FMD in Uttar Pradesh, India. The Haryana Veterinarian. 47: 107-109.
19. Verma, A. K., Mahima, Pal, B.C., Yadav, S.K., Kumar, A., Raies, M. (2010). Phylogenetic relationships between foot-and-mouth disease virus serotype ‘A’ isolates and vaccine strains, Onl J Vet Res. 14 (1):87-95.
20. Verma, A.K., Kumar, A., Mahima and Sahzad (2012). Epidemiology and diagnosis of foot and mouth disease: a review. Indian Journal of Animal Sciences, 82 (6): 543-551.
21. Verma, A.K., Pal, B.C., Singh, C.P., Jain, U., Yadav, S.K. and Mahima. (2008). Studies of the outbreaks of foot-and-mouth disease in Uttar Pradesh, India, between 2000 and 2006. Asian Journal of Epidemiology, 1(2):40-46.
22. Verma, AK, Tripathi, A.K. and Neha (2017). Investigation of FMD Outbreak in District Bulandsahar, Uttar Pradesh, India. International Journal of Livestock Research, 7(4): 113-119.