NAAS Score 2020

                   5.36

UserOnline

Free counters!

Previous Next

Virulence Characterization of Campylobacter jejuni Isolated from Poultry in India

Rahul Yadav and Sunil Maherchandani
Vol 10(3), 132-140
DOI- http://dx.doi.org/10.5455/ijlr.20200117043429

The present study was conducted for detection of various virulence factor (adherence, invasion, colonization, motility, lipo-oligosacchrides) and cytolethal distending toxin genes along antibiotic resistance determination among Campylobacter jejuni isolates of poultry origin in India. Adherence and lipo-oligosacchrides genes i.e. cadF, porA, jlpA, dnaJ, wlaN, waaC and capA were detected in 97.67%, 93.02%, 90.69%, 88.37%, 88.37%, 65.11% and 51.16% of the isolates respectively. Cytolethal distending toxin genes i.e. cdtC, cdtA and cdtB, were detected in higher proportions (86.04% to 97.67%) followed by flagellin gene i.e flaAflaBflgR (69.76% to 100%) and invasion genes i.e. iamAB, pldAand ciaB (34.88% to 88.37%) isolates. Further, phylogenetic analysis of iamAB gene revealed their unique genetic makeup and didn’t found homology from Indian origin.


Keywords : Campylobacter jejuni Poultry Virulence Genes

Campylobacter had received serious attention as causative agent of diarrhoea only since 1973 among human population (Butzler et al., 1973). C. jejuni is responsible for the majority (80-90%) of these infections and is now a second most emerging food borne zoonotic pathogen after Salmonella (Andrzejewska et al., 2011; Epps et al., 2013). Poultry are considered to be its major reservoir as bacterium efficiently colonizes into caecal mucosal crypts of the gastrointestinal tract (Moore et al., 2005; Bolton, 2015; Mani et al., 2018). These microaerophillic gram-negative rods possess several virulence factors associated with their survival and pathogenicity, however pathogenesis of infections is still not clearly understood (Lluque et al., 2017). The major virulence attribute of C. jejuni are adhesion, invasion, presence of lipo-oligosacchrides responsible for evading host defense mechanism and production of cytotoxins (Datta et al., 2003; Fouts et al., 2005; Bolton, 2015). Adherance is governed by Campylobacter adhesion protein A (capA) a autotransporter responsible for initial step of interaction (Flanagan et al., 2009), factor for Campylobacter adhesion to fibronectin (cadF) (Rizal et al., 2010; Mahmoodipour et al., 2017), heat shock proteins (dnaJ), thermoregulation protein (Rozynek et al., 2005), major outer membrane protein (MOMP) also called porA (Flanagan et al., 2009) and a surface expressed lipoprotein loosely attached to the bacterial cell surface (jlpA) (Jin et al., 2003). Lipo-oligosacchrides (LOS) (different from LPS) lack an O-polysaccharide chain and plays a crucial role in immune avoidance, serum resistance, adherence and invasion of intestinal epithelial cell (Javed et al., 2012; Yang et al., 2014). The two locomotors flagellar filament flaA (major flagellin) and flaB (minor flagellin) govern motility, initial interaction to host, antigenic phage variation, invasion and colonization of gastrointestinal tract (Casabonne et al., 2016). Their expression is regulated by response regulator flgR gene. Colonization leads to production of bacterial tripartitecytolethal distending toxins (CDT) encoded by three linked genes i.e. cdtA, cdtB and cdtC, causing severe enteritis including severe abdominal cramps, diarrhea with blood or mucus and fever (Lee and Newell, 2006; Gargi, 2013; Zhang et al., 2016). Invasion associated marker (iam) is responsible for invasion and colonization of multiple hosts (Jribi et al., 2017).

Wide strain variations have been reported detection of virulence associated genes from different geographical locations (Gonzalez-Hein et al., 2013) all over the world but there is lack of documentation from Indian origin C. jejuni isolates. Therefore, present study was carried out for detection of virulence and toxin associated genes from poultry origin in India.

Material and Methods

A total of 43 C. jejuni isolated during 2014-2016 from local poultry farms in and around Bikaner, India in previous study (Yadav et al., 2016) were subjected for determination of virulence associated genes.

Amplification of Virulence Associated Genes

Detection of various virulence factors was done using primer sets as reported earlier or designed for the present study (Table 1). The DNA extraction was carried out as described in previous study (Ertas et al., 2004; Yadav et al., 2016). All PCR amplifications were performed in a mixture (25 μl) containing: 2.5μl of the 10X PCR buffer, 2.5μl of MgCl2 (25 mM), 0.5 μl of dNTPs (10 mM), 1 μl of each primer (100 μM), 0.5 μl (1U) of the Taq DNA polymerase (Promega), 3 μl (50-100 ng) of the bacterial template DNA and 14 μl nuclease free water. The PCR products were analyzed by electrophoresis on 1.5% agarose gel for 1 h at 100V. The gel was then visualized under UVP gel documentation system (BioDoc-It Imaging System).

Table 1: PCR primers and conditions for detection of virulence associated genes

S.no Virulence factors Gene Primer sequence A. temp (°C) Size (bp) References
name
1 Adherence cadF F- TTGAAGGTAATTTAGATATG 45 400 Konkel et al. (1999)
R- CTAATACCTAAAGTTGAAAC
2 capA F-TGAATCGAAGTGGAAAAATAGAAG 60 1351 Flanagan et al. (2009)
R- CCCATTTTTGTATCTTCATAACCT
3 jlpA F- TCTCAGGACTCTGGAATAAAGATTG 60 868 Flanagan et al. (2009)
R-GTGTGCTATAGTCACTAACAGGGATG
4 porA F- CAATTTGACTATAATGCTGCTGATG 50 932 Chae et al. (2012)
R- ATGCTGAGAAGTTAAGTTTTGGAGA
5 dnaJ F- AAGGCTTTGGCTCATC 46 720 Datta et al. (2003)
R- CTTTTTGTTCATCGTT
6 Lipooligosachrides LOS-wlaN F- TGCTGGGTATACAAAGGTTGTG 60 330 Muller et al. (2006)
R- AATTTTGGATATGGGTGGGG
7 waaC F- TAATGAAAATAGCAATTGTTCGT 42 1029 Khoshbakht et al. (2013)
R-GATACAAAAATCACTTTTATCGA
8 Motility flaA F- GGATTTCGTATTAACACAAATGGTGC 52 1725 Nachamkin et al. (1993)
R- CTGTAGTAATCTTAAAACATTTTG
9 flaB F- ATAAACACCAACATCGGTGCA 50 1670 Chae et al. (2012)
R- GTTACGTTGACTCATAGCATA
10 flgR F- GAGCGTTTAGAATGGGTGTG 54 390 Wilson et al. (2010)
R- GCCAGGAATTGATGGCATAG
11 Invasion iamAB F- CGACTACTATGCGGATCAAG 53 601 This study
R- TTGTAAATGCTATATTTTGGG
12 ciaB F- TTTTTATCAGTCCTTA 42 986 Datta et al. (2003)
R- TTTCGGTATCATTAGC
13 pldA F- AAGCTTATGCGTTTTT 45 913 Datta et al. (2003)
R- TATAAGGCTTTCTCCA
14 Cytolethal distending toxins cdtA F- CCTTGTGATGCAAGCAATC 49 370 Talukder et al. (2008)
R-ACACTCCATTTGCTTTCTG
15 cdtB F- CAGAAAGCAAATGGAGTGTT 51 620 Talukder et al. (2008)
R- AGCTAAAAGCGGTGGAGTAT
16 cdtC F- CGATGAGTTAAAACAAAAAGATA 47 182 Talukder et al. (2008)
R- TTGGCATTATAGAAAATACAGTT

Sequence Analysis of iamAB Gene

The primers were designed by primer 3 tool of NCBI for iamAB gene from genebank at NCBI (Accession no. AF023133). PCR products from three isolates were sequenced (DNA Sequencing Facility, Delhi University). The sequences obtained were subjected to nucleotide BLAST (Basic Local Alignment Search tool) to determine the similarity with the already prevalent gene sequences and were published with accession numbers KX840464, KX840465 and KX840466 respectively in NCBI gene bank database. The sequences were also aligned using Bio edit and MEGA6 software to study the variations in the nucleotide sequences and their phylogenetic cluster analysis (Bikandi et al., 2004).

Results and Discussion

Campylobacter jejuni are blessed with some adherence, invasion and some cell surface expressive virulent factors responsible for its high prevalence and pathogenicity as compared to other enteric bacteria (Biswas et al., 2011). All the 43 isolates of C. jejuni were subjected to the PCR detection for 16 virulence genes associated with adherence, invasion, flagellin, Lipo-oligosacchrides and toxin production (Fig.1).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Fig. 1: Agarose gel electrophoresis image of various virulence associated genes of C. jejuni

Flagellin gene, flaA was detected in all the isolates followed by flaB gene and flgR gene in 72.09% and 69.76 % of the isolates. The flaA gene also has role in type III secretion apparatus for the Campylobacter invasion antigens (Cia proteins) important for in vitro cell invasion (Konkel et al., 2004; Khoshbakht et al., 2013) and chick colonization (Ziprin et al., 2001). Chickens exposed to the flgR (flaA and flaB expression regulator) mutants showed delayed colonization (Hermans et al., 2011).

Adherence associated genes namely; cadF, capA, jlpA, porA and dnaJ were found to be present in 97.67%, 51.36%, 90.69%, 93.02% and 83.37% of the isolates respectively. There were 44.18% isolates having all the five adherence associated genes. The active role of adherence associated genes in pathogenesis and colonization of C. jejuni has been reported previously (Negrettiet al., 2017). cadF deletion mutants of C. jejuni had 50-60% reduction in binding to immobilized fibronectin, intestinal human cells (INT 407) and caecum epithelial cells (Chansiripornchai and Sasipreeyajan 2009). Likewise, capA deletion mutant exhibited 47% reduction in binding of Campylobacter to chicken LMH epithelial cells in comparison to wild-type isolate (Fouts et al., 2005). The jlpA (Jejuni lipoprotein A) was identified in having role in binding to HEp-2 cells (Flanagan et al., 2009). The jlpA null mutant reduced binding of such Campylobacter by 18-19.4% when compared to wild-type C. jejuni; however, no difference in invasion was observed (Jin et al., 2003). Both the lipo-oligosaccharides genes namely wlaN and waaC were found in 88.37% and 65.11% of the isolates and in total 60.46% of the isolates had both the genes. The wlaN gene has a role in biosynthesis of lipo-oligosacchrides molecules and regulation of protein glycosylation whereas waaC encodes for heptosyltransferase I and attaches the first heptose (HEp-I) to Kdo (Karlyshev et al., 2005).

The C. jejuni isolates from present study were found highly toxic as all three cytolethal distending toxin linked genes i.e. cdtA, cdtB, and cdtC genes were found in 93.02%, 86.04% and 97.67% of the isolates. Cytolethal distending toxin (CDT) is a complex acting together to block cell division by performing cell cycle arrest (Ge et al., 2008). The cdtB is the active holotoxin and causes cell cycle arrest by cleaving dsDNA molecules during the G1 and G2 phase (Ramachandran et al., 2017). The genes cdtA and cdtC usually bind to the cell surface and help in the delivery of active subunit CdtB to cause DNA damage (Ghorbanalizadgan et al., 2014). Invasion associated genes iamAB, pldA and ciaB genes were detected in 88.37%, 46.51% and 34.88% of the isolates.Invasion associated marker (iam) is 1.6 kb genetic marker having ABC transporter (iamA) gene and integral membrane protein (iamB) gene and have been found to be associated with adherence and invasion of Hep-2 cells in vitro (Carvalho et al., 2001).

Sequence Analysis of iamAB Gene

On comparison of partial sequences of iamAB gene namely KX840464 of C4 isolate, KX840465 of C22 isolate and KX840466 of C23 isolate, five nucleotide variations were observed in KX840464 as compared to KX840465 and KX840466 viz. A166G (Met to Ile), C255T (Phe to Ser), C261T (Leu to Ser), A385G (Ser to Ser), and G426T (Phe to Cys). KX840465 (C22) and KX840466 (C23) were identical. For phylogenetic analysis, in addition to three isolates from the current study, we selected 15 sequences (from across the world) of iamAB gene from the public domain. The phylogenetic tree constructed using these 18 sequences revealed three major clusters (Fig. 2).

Fig. 2:  Phylogenetic analysis of iamAB gene sequences

All three isolates under study grouped under a separate cluster (cluster III). Though, sequences of iamAB gene for other isolates from India are unavailable in the public domain but separation of the isolates into an entirely different cluster suggests their unique genetic character. The only single poultry isolate (originating from UK) available in the public domain did not cluster together with the isolates under study; rather it grouped under a separate cluster (cluster II). Cluster I and cluster II represented C. jejuni isolates from US, Canada, Finland, UK and most of them belonged to humans. Taken together, we didn’t found any iamAB gene sequence of C. jejuni isolates originating from India in public domain. Thus, the phylogenetic analysis of iamAB gene sequences from present study isolates suggested their unique genetic makeup.

Conclusion

  1. jejuni isolates from present study were detected as potentially pathogenic by presence of number of virulence genes in high proportions. The isolates had potential to produce cytolethal distending toxin due to high presence of tripartite cdt gene complex. To our best knowledge, we didn’t find any iamAB partial gene cds of Indian origin C. jejuni isolates published in public domain. The phylogenetic analysis of iamAB gene sequences revealed their unique genetic identity to the sequence taken from rest parts of the world.

Acknowledgment

The study was funded by Rajasthan University of Veterinary and Animal Sciences University (RAJUVAS), Bikaner as part of Ph.D dissertation of  the  first  author Dr. Rahul Yadav under supervision of major advisor Prof. Sunil Maherchandani.

Conflict of Interest

Authors don’t have any conflict of interest.

References

  1. Andrzejewska, M., Klawe, J., Szczepańska, B., & Spica, D. (2011). Occurrence of virulence genes among Campylobacter jejuni and Campylobacter coli isolates from domestic animals and children. Polish Journal of Veterinary Sciences14(2), 207-211.
  2. Bikandi, J., Millán, R. S., Rementeria, A., & Garaizar, J. (2004). In silico analysis of complete bacterial genomes, PCR, AFLP–PCR and endonuclease restriction. Bioinformatics20 (5), 798-799.
  3. Biswas, D., Hannon, S. J., Townsend, H. G., Potter, A., &Allan, B. J. (2011). Genes coding for virulence determinants of Campylobacter jejuni in human clinical and cattle isolates from Alberta, Canada, and their potential role in colonization of poultry. International Microbiology14(1), 25-32.
  4. Bolton, D. J. (2015). Campylobacter virulence and survival factors. Food Microbiology48, 99-108.
  5. Butzler, J. P., Dekeyser, P., Detrain, M., & Dehaen, F. (1973). Related vibrio in stools. The Journal of Pediatrics82(3), 493-495.
  6. Carvalho, A. C., Ruiz-Palacios, G. M., Ramos-Cervantes, P., Cervantes, L. E., Jiang, X., & Pickering, L. K. (2001). Molecular characterization of invasive and noninvasive Campylobacter jejuni and Campylobacter coli isolates. Journal of Clinical Microbiology39(4), 1353-1359.
  7. Casabonne, C., Gonzalez, A., Aquili, V., Subils, T., &Balague, C. (2016). Prevalence of seven virulence genes of Campylobacter jejuni isolated from patients with diarrhea in Rosario, Argentina. International Journal of Infection3(4).
  8. Chae, M. J., Kim, H. J., Kim, J. H., Kim, J. W., Ku, B. K., &Lee, Y. J. (2012). Characteristics of in vitro virulence properties in Campylobacter sp. isolated from chicken carcasses. Journal of Animal and Veterinary Advances, 11(6), 704-711.
  9. Chansiripornchai, N., & Sasipreeyajan, J. (2009). PCR detection of four virulence-associated genes of Campylobacter jejuni isolates from Thai broilers and their abilities of adhesion to and invasion of INT-407 cells. Journal of Veterinary Medical Science71(6), 839-844.
  10. Datta, S., Niwa, H., & Itoh, K. (2003). Prevalence of 11 pathogenic genes of Campylobacter jejuni by PCR in strains isolated from humans, poultry meat and broiler and bovine faeces. Journal of Medical Microbiology52(4), 345-348.
  11. Epps, S., Harvey, R., Hume, M., Phillips, T., Anderson, R., &Nisbet, D. (2013). Foodborne Campylobacter, infections, metabolism, pathogenesis and reservoirs. International Journal of Environmental Research and Public Health10(12), 6292-6304.
  12. Flanagan, R. C., Neal-McKinney, J. M., Dhillon, A. S., Miller, W. G., & Konkel, M. E. (2009). Examination of Campylobacter jejuni putative adhesins leads to the identification of a new protein, designated FlpA, required for chicken colonization. Infection and Immunity77(6), 2399-2407.
  13. Fouts, D.E., Mongodin, E.F., Mandrell, R.E., Miller, W.G., Rasko, D.A., Ravel, J., Brinkac, L.M., DeBoy, R.T., Parker, C.T., Daugherty, S.C. &Dodson, R.J. (2005). Major structural differences and novel potential virulence mechanisms from the genomes of multiple Campylobacter species. PLoS Biology3(1), p.e15.
  14. Gargi, A., Tamilselvam, B., Powers, B., Prouty, M.G., Lincecum, T., Eshraghi, A., Maldonado-Arocho, F.J., Wilson, B.A., Bradley, K.A. & Blanke, S. R. (2013). Cellular interactions of the cytolethal distending toxins from Escherichia coli and Haemophilusducreyi. Journal of Biological Chemistry288(11), 7492-7505.
  15. Ge, Z., Schauer, D. B., &Fox, J. G. (2008). In vivo virulence properties of bacterial cytolethal‐distending toxin. Cellular Microbiology10(8), 1599-1607.
  16. Ghorbanalizadgan, M., Bakhshi, B., Lili, A. K., Najar-Peerayeh, S., &Nikmanesh, B. (2014). A molecular survey of Campylobacter jejuni and Campylobacter coli virulence and diversity. Iranian Biomedical Journal18(3), 158.
  17. González-Hein, G., Huaracán, B., García, P., &Figueroa, G. (2013). Prevalence of virulence genes in strains of Campylobacter jejuni isolated from human, bovine and broiler. Brazilian Journal of Microbiology44(4), 1223-1229.
  18. Hermans, D., Van Deun, K., Martel, A., Van Immerseel, F., Messens, W., Heyndrickx, M., Haesebrouck, F. & Pasmans, F. (2011). Colonization factors of Campylobacter jejuni in the chicken gut. Veterinary Research42(1), 82.
  19. Javed, M.A., Cawthraw, S.A., Baig, A., Li, J., McNally, A., Oldfield, N.J., Newell, D.G. & Manning, G. (2012). Cj1136 is required for lipooligosaccharide biosynthesis, hyperinvasion, and chick colonization by Campylobacter jejuni.Infection and immunity80(7), 2361-2370.
  20. Jin, S., Song, Y.C., Emili, A., Sherman, P.M. & Chan, V. L. (2003). JlpA of Campylobacter jejuni interacts with surface‐exposed heat shock protein 90α and triggers signalling pathways leading to the activation of NF‐κB and p38 MAP kinase in epithelial cells. Cellular microbiology5(3), 165-174.
  21. Jribi, H., Sellami, H., Hassena, A.B. & Gdoura, R. (2017). Prevalence of putative virulence genes in Campylobacter and Arcobacter species isolated from poultry and poultry by-products in Tunisia. Journal of Food Protection80(10), 1705-1710.
  22. Karlyshev, A. V., Ketley, J. M. & Wren, B. W. (2005). The Campylobacter jejuniFEMS Microbiology Reviews29(2), 377-390.
  23. Khoshbakht, R., Tabatabaei, M., Hosseinzadeh, S., Shekarforoush, S. S., &Aski, H. S. (2013). Distribution of nine virulence-associated genes in Campylobacter jejuni and C. coli isolated from broiler feces in Shiraz, Southern Iran. Foodborne Pathogens and Disease10(9), 764-770.
  24. Konkel, M. E., Gray, S. A., Kim, B. J., Garvis, S. G., &Yoon, J. (1999). Identification of the Enteropathogens Campylobacter jejuni and Campylobacter coli based on the cadF Virulence Gene and Its Product. Journal of Clinical Microbiology37(3), 510-517.
  25. Konkel, M. E., Klena, J. D., Rivera-Amill, V., Monteville, M. R., Biswas, D., Raphael, B., & Mickelson, J. (2004). Secretion of virulence proteins from Campylobacter jejuni is dependent on a functional flagellar export apparatus. Journal of Bacteriology186(11), 3296-3303.
  26. Lee, M. D., &Newell, D. G. (2006). Campylobacter in poultry, filling an ecological niche. Avian Diseases50(1), 1-9.
  27. Lluque, A., Riveros, M., Prada, A., Ochoa, T. J., &Ruiz, J. (2017). Virulence and antimicrobial resistance in Campylobacter spp. from a Peruvian pediatric cohort. Scientifica, 2017.
  28. Mahmoodipour, H., Baserisalehi, M., & Emami, A. (2017). Molecular detection of virulence genes involved in adherence colonization Invasion and cytotoxin production in Campylobacter jejuni and Campylobacter Coli isolated from poultry cow and sheep faeces. ActaMedicaMediterranea,33, 763.
  29. Mani, M., Pandey, R., Rautela, R. & Trivedi, R. (2018). Epidemiological Studies on Animals and Humans as Reservoirs of Thermophilic Campylobacters. International Journal of Livestock Research, 8(6), 203-211.
  30. Moore, J.E., Corcoran, D., Dooley, J.S., Fanning, S., Lucey, B., Matsuda, M., McDowell, D.A., Mégraud, F., Millar, B.C., O’Mahony, R. & O’Riordan, L., 2005. Campylobacter. Veterinary Research36(3), pp.351-382.
  31. Müller, J., Schulze, F., Müller, W. & Hänel, I. (2006). PCR detection of virulence-associated genes in Campylobacter jejuni strains with differential ability to invade Caco-2 cells and to colonize the chick gut. Veterinary Microbiology113(1-2), 123-129.
  32. Nachamkin, I., Bohachick, K., &Patton, C. M. (1993). Flagellin gene typing of Campylobacter jejuni by restriction fragment length polymorphism analysis. Journal of Clinical Microbiology31(6), 1531-1536.
  33. Negretti, N. M., &Konkel, M. E. (2017). Methods to study Campylobacter jejuni adherence to and invasion of host epithelial cells. In Campylobacter jejuni(pp. 117-127). Humana Press, New York, NY.
  34. Ramachandran, N., Ramlal, S., &Batra, H. V. (2017). Confirmed identification and toxin profiling of Campylobacter jejuni using a thermostabilized multiplex PCR formulation. Apmis125(7), 641-649.
  35. Rizal, A., Kumar, A., &Vidyarthi, A. S. (2010). Prevalence of pathogenic genes in Campylobacter jejuni isolated from poultry and human. Internet Journal of Food Safety12, 29-34.
  36. Rozynek, E., Dzierzanowska-Fangrat, K., Jozwiak, P., Popowski, J., Korsak, D., &Dzierzanowska, D. (2005). Prevalence of potential virulence markers in Polish Campylobacter jejuni and Campylobacter coli isolates obtained from hospitalized children and from chicken carcasses. Journal of Medical Microbiology54(7), 615-619.
  37. Talukder, K.A., Aslam, M., Islam, Z., Azmi, I.J., Dutta, D.K., Hossain, S., Nur-E-Kamal, A., Nair, G.B., Cravioto, A., Sack, D. A. & Endtz, H. P. (2008). Prevalence of virulence genes and cytolethal distending toxin production in Campylobacter jejuni isolates from diarrheal patients in Bangladesh. Journal of clinical microbiology46(4),1485-1488.
  38. Wilson, D.L., Rathinam, V.A., Qi, W., Wick, L.M., Landgraf, J., Bell, J.A., Plovanich-Jones, A., Parrish, J., Finley, R.L., Mansfield, L.S. & Linz, J.E. (2010). Genetic diversity in Campylobacter jejuni is associated with differential colonization of broiler chickens and C57BL/6J IL10-deficient mice. Microbiology156(Pt 7), p.2046.
  39. Yadav, R., Gahlot, K., Yadav, J., Purva, M., Bhati, T., Deora, A; Kumar, P., Maherchandani, S., & Kashyap, S.K. (2016). Prevalence of thermophilic Campylobacter jejuni isolated from Cloacal samples of poultry. Haryana Veterinarian, 55(2), 195-197.
  40. Yang, J.W., Kim, S.H., Lee, W.W. & Kim, Y. H. (2014). Prevalence of virulence-associated genes and antimicrobial resistance of Campylobacter jejuni from ducks in Gyeongnam Province, Korea. Korean Journal Veterinary Services,37(2), 85-96.
  41. Zhang, T., Luo, Q., Chen, Y., Li, T., Wen, G., Zhang, R., Luo, L., Lu, Q., Ai, D., Wang, H. &Shao, H., 2016. Molecular epidemiology, virulence determinants and antimicrobial resistance of Campylobacter spreading in retail chicken meat in Central China. Gut pathogens8(1), 48.
  42. Ziprin, R. L., Young, C.R., Byrd, J. A., Stanker, L. H., Hume, M. E., Gray, S. A., Kim, B. J. &Konkel, M. E. (2001). Role of Campylobacter jejuni potential virulence genes in cecal colonization. Avian Diseases, 549-557.
Full Text Read : 596 Downloads : 154
Previous Next

Open Access Policy

Close