Introduction

Growth, carcass and meat quality traits are polygenic and considered as economically important traits in small ruminants meant for meat purpose. Selection of animals for enhanced growth and carcass conformation/ composition is of utmost significance for the breeders/ farmers and consumers. The recent gene based methods expedited the improvement of traits that are difficult to improve by traditional phenotype based methods. The gene based methods involves identifying the genes that have major effect on specific traits and determining the polymorphism in such genes i.e., candidate genes which may be associated with the trait variation. The ‘Calpain-Calpastatin System’ (CCS) is constituted of three well characterized proteins, which include two ubiquitous Ca²⁺ dependent proteolytic enzymes (µ and m calpain), whereas, calpastatin is the third member capable of preventing more than one calpain molecule. The CCS plays a major role in skeletal muscle growth, developmental processes and meat production and quality (Goll et al., 2003). The ovine calpastatin genes may be considered as potential candidate genes for growth, carcass and meat quality traits (Palmer et al., 1999a).

Many research studies have confirmed the association of calpastatin polymorphism with growth and meat quality traits. Nassiry et al. (2006) in a study in Iranian Kurdi sheep found that AB genotype had higher daily weight gain, and Palmer et al. (1999a) reported that AC genotype was having increased live weight and carcass weight in the crossbred Dorset and Coopworth sheep. Bandur sheep, which is also known as Mandya sheep, is one of the best mutton breed of the State and the Country because of its conformation and unique organoleptic characteristics. But there is inadequate literature pertaining to carcass and meat quality traits and their possible association with calpastatin gene. In this regard, the present study intended to study the association of calpastatin polymorphism with carcass and meat quality traits in Bandur Sheep.

Materials and Methods

The research was conducted at Livestock Research and Information Centre (Sheep), KVAFSU, Nagamangala, Mandya district, Karnataka, India.

Experimental Animals

Genotyping study was undertaken on 100 Bandur ram lambs distributed over the villages of Malavalli taluk, Mandya district as well as from Livestock Research and Information Centre (Sheep), KVAFSU, Nagamangala. Carcass and meat quality characteristics were studied in 18 ram lambs belonging to three calpastatin genotypes (six animals per genotype).

Genetic Polymorphism of Calpastatin

About five ml of blood sample was collected from each animal in a vacutainer tube containing 0.5 per cent Ethylene Diamine Tetra Acetic acid (EDTA). The blood samples were immediately transported to the laboratory at 4 °C and genomic DNA was isolated within 24 hours by following high salt method as described by Miller et al. (1988) with necessary modifications. The quality and quantity of the genomic DNA were ascertained by UV spectrophotometer (Biophotometer plus, Eppendorf, Germany). Published primers viz., Forward: 5′ TGGGGCCCAATGACGCCATCGATG 3′ and Reverse: 5′ GGTGGAGCAGCACTTCTGATCACC 3′ (Palmer et al., 1998; Nassiry et al., 2006) were employed for amplification of exon 1C/ 1D and the intervening intron between them from a portion of the first repetitive domain of the ovine calpastatin gene.

The amplification reactions were carried out in 0.2 ml microfuge tubes using a Master cycler gradient (Bio Rad S1000, USA). The 25 µl reaction mixture consisted of 12.5 µl of Red PCR Master Mix (Amnion biosciences Pvt. Ltd), 1 µl (10 pmol/ µl) each of Forward (Exon 1C) and Reverse (Exon 1D) primer, 9.5 µl of PCR grade water and 1 µl (100 ng) of template DNA. The PCR protocol used for amplification involved an initial denaturation temperature of 95 ^°C (5 min), 33 cycles of 94 ^°C (1 min), 60 ^°C (1 min) and 72 ^°C (2 min), followed by final extension at 72 ^°C (8 min). Amplified PCR products were resolved on 1.5 per cent agarose gel along with 100 bp DNA ladder at a constant voltage of 100 V for 45 to 60 minutes in 1X TAE buffer. The restriction enzymes MspI (Morexella species) and NcoI (Nocardia corallina) were used to digest the PCR amplicons of calpastatin. The optimized RE digestion mixture consisted of 3.5 µl of autoclaved triple distilled water, 1 µl of 10 X assay buffer for RE, 0.5 µl of restriction enzyme (10 U/µl) and 5 µl of PCR product to form 10 µl digestion mixture. The reaction mixture was vortexed for few seconds for uniform mixing and then incubated at 37 °C for 12 hrs. The restriction enzyme digested PCR products were electrophoresed on two per cent agarose gel containing ethidium bromide (1%) along with 100 bp DNA ladder at a constant voltage of 100 V for 90 minutes using 1X TAE buffer. The restriction pattern resolved by agarose gel electrophoresis was photographed and analyzed using gel documentation system (Bio Rad, USA).

The genotype was determined by scoring the bands under the gel documentation system. The allele number, allele frequency and genotype frequency were calculated as described by Rosner (2005).

Carcass and Meat Quality Study

All the lambs selected were weaned at the age of three months and then raised under similar environmental conditions. Animals were fed a ration without limitation to achieve finishing weight. The animals were slaughtered after obtaining due permission from the Institutional Animal Ethics Committee (No. LPM/IAEC/172/2013, dt: 25.09.2013).

All the lambs were slaughtered at the age of six months with a 12 hours fasting period before slaughter. Pre slaughter weights were recorded and the animals were slaughtered under hygienic conditions by Halal method. Sticking, legging, dressing and evisceration were performed as per the procedure described by Gerrard (1964). The cut surface of Longissimus thoracis et lumborum muscle at the interface of 12^th and 13^th ribs on both side of the carcass was marked on tracing paper and measured by a planimeter (PLACOM Fuji, Japan) with standard procedure as loin eye area (cm²). The carcass was cut into different primal cuts viz., leg, loin, rack, neck and shoulder, flank, and breast and fore shank as per specifications of ISI (1995). Based on the pre slaughter weight dressing percentage was estimated. The assessment of pH of the Longissimus thoracis et lumborum muscle (2-4 hours after slaughter) was done using a digital pH meter. The meat color (Longissimus thoracis et lumborum muscle) was tested using Hunter Lab Mini scan XE plus separate colorimeter with geometry of diffuse/ 80 (sphere–8mm view) and an illuminant of D65/ 10 deg (Reston Virginia, USA). Colorimetry measures colour with quantitative physical methods and defines them within well-established numerical values. Here they are expressed using the standard Hunter L*, a*, b* system. The hue (relative position of colour between redness and yellowness) and chroma (colour intensity) was calculated as follows:

Average value for each colour parameter was determined by taking observations from five different places of meat samples.

Water holding capacity was measured by the standard filter paper press method recommended by Grau and Hamm (1953 and 1957) with few modifications. The water holding capacity (%) was calculated by following formula:

The meat tenderness of Longissimus thoracis et lumborum muscle was determined by Warner-Bratzler shear (G-R Elec Co., Manhattan, USA) and expressed as kg/ cm². Meat chunks were sealed in low density polyethylene bags and placed in a water bath maintained at 80 °C for 30 minutes with final internal temperature of 60 °C. Later the temperature of meat chunks was brought to room temperature. The weight of meat chunks was recorded before and after cooking. The cooking loss was calculated by following formula and expressed in percentage.

About 250 g of meat samples containing representative samples from all primal cuts were thoroughly minced, packed in polythene bags, labelled and kept at – 80 °C. Eighteen meat samples (Six samples for each CAST genotype) were sent to Animal Feed Analytical and Quality Assurance Laboratory, TANUVAS, Veterinary College and Research Institute, Namakkal, Tamil Nadu for proximate analysis with gross energy and omega 3 Fatty acids estimation. Descriptive statistics of different carcass weights, carcass components and meat quality traits were determined as per Snedecor and Cochran procedures (1989).

Association Study

By following ANOVA in GLM procedures of SAS 9.3(SAS Institute Inc., Cary, NC, USA), association between CAST genotypes and carcass and meat quality traits was analysed, keeping genotype as independent variables in linear model.

Results and Discussion

Genetic Polymorphism of Calpastatin

A 620 bp amplified product was resolved on 1.5 per cent agarose gel electrophoresis as shown in Fig. 1.

Fig. 1: Agarose (1.5 %) electrophoresis gel showing amplification of exon 1C/ 1D and the intervening intron region of calpastatin gene

The product size and identity of PCR products were further confirmed through sequencing of PCR products. Several studies reported amplification of ovine CAST gene (Szkudlarek-Kowalczyk et al., 2011; Suleman et al., 2012; Nikmard et al., 2012) using same set of primers as used in the present study.

RFLP digestion of PCR products yielded two alleles viz., M and N. The presence of these two alleles in CAST gene was well differentiated using the two restriction enzymes having differing restriction sites. The PCR-RFLP pattern for animals that were homozygous for M allele (MM) produced two and one bands by MspI and NcoI, respectively, animals that were homozygous for N allele (NN) produced one and two bands by MspI and NcoI, respectively and the animals which were heterozygous (MN) yielded three bands each for both MspI and NcoI on two per cent agarose gel electrophoresis as shown in Fig. 2.

Fig. 2: Agarose (2 %) electrophoresis gel showing PCR-RFLP pattern of calpastatin gene

Lane 1 & 8 – 100 bp Ladder Lane 2, 4, 6 – CAST/MspI genotypes MM, MN & NN and

Lane 3, 5, 7 – CAST/NcoI genotypes MM, MN & NN

The allele and genotype frequencies and observed and expected heterozygosities for CAST gene observed in the Bandur ram lamb population are presented in Table 1. Further, the studied population was found to be in Hardy Weinberg equilibrium.

Table 1:  Allele and genotypic frequencies, observed and expected heterozygosity and χ² value for CAST genotype

Figures in the parenthesis showing number of animals

Earlier reports have confirmed that the restriction enzymes MspI and NcoI, by having different restriction sites, differentiated the two alleles present at CAST loci (Palmer et al., 1998; Sutikno et al., 2011; Szkudlarek-Kowalczyk et al., 2011; Dehnavi et al., 2012) in different breeds of sheep. The results are in concurrence with the reports of several workers in different sheep breeds viz., allele frequencies of 0.5545 and 0.4455 in Dalagh sheep of Iran (Azari et al., 2012), 0.638 and 0.362 in Lori sheep (Nanekarani et al., 2011), 0.544 and 0.456 in synthetic Karya sheep of Turkey (Ata and Cemal, 2013) were observed for M and N, respectively. Whereas, allele frequency of 0.69, 0.48 and 0.50 was observed for M allele in Ghezel, Arkhamerino and Ghezel x Arkhamerino sheep, respectively (Elyasi et al., 2009).

In contrast to the present study, Palmer et al. (1998) reported 0.77 and 0.23 as the allele frequency for M and N alleles, respectively in Corriedale rams. Similarly, higher values for allele M were also reported in different sheep breeds of India (CSWRI, 2012), Iran (Shahroudi et al., 2006 and Gharahveysi et al., 2012), Slovakia (Gabor et al., 2009), Pakistan (Suleman et al., 2012) and Poland (Szkudlarek-Kowalczyk et al., 2011). In agreement to the present study, Elyasi et al. (2009), Nanekarani et al. (2011), Azari et al. (2012) also reported higher MN genotype frequency than MM and NN in Arkhamerino and Ghezel x Arkhamerino sheep, Lori sheep and Dalagh sheep. Whereas, contrast to the present study, Palmer et al. (1998), Shahroudi et al. (2006), Gharahveysi et al. (2012) concluded that MM genotype was found to be higher in different sheep breeds. However, sheep breeds of Poland (Szkudlarek-Kowalczyk et al., 2011) and Slovakia (Gabor et al., 2009) showed only two genotypes, MM and MN.

With regard to the observed and expected heterozygosities, similar findings were reported by Ata and Cemal (2013) in Cine Capari (0.410 and 0.376) and Karya sheep (0.520 and 0.446). Whereas, low observed heterozygosity of 0.25 and 0.24 was reported in Zel (Dehnavi et al., 2012) and Kurdi sheep (Nassiry et al., 2007).

Association Study

Association between CAST Genotypes and Carcass Traits

The association between CAST genotypes and mean values of carcass weight and dressing percentage are presented in Table 2. The pre slaughter weight, hot carcass weight and dressing percentage were not significantly different with regard to CAST genotypes.

Table 2: Association between CAST genotypes and mean values of carcass weight and dressing percentage in Bandur ram lambs

NS: non significant

The association between CAST genotypes and non-carcass components, edible and inedible organ percentage and loin eye area are presented in Table 3. Among all the non-carcass components, only the skin weight of MM and MN genotype was significantly (P<0.05) higher than NN genotype.

Table 3:  Association between CAST genotypes and mean values of non-carcass components, percentage of edible and inedible offal and loin eye area Bandur ram lambs

Means bearing same superscripts do not differ significantly; *Significant (P<0.05), NS: non significant

The association between the CAST genotype and carcass primal cuts, and meat and bone composition of cuts are presented in Table 4. There was no significant difference between the carcass primal cuts, meat and bone composition and CAST genotypes. With regard to carcass traits, in the present study no significant differences were observed between the different CAST genotypes except skin weight.

In agreement to the present study, no significant association was observed between CAST genotypes (MM, MN, NN) with carcass traits (back fat thickness and longissimus muscle area post finishing) in Afshari sheep of Iran (Nikmard et al., 2012). However, In a small groups of Dorset Down and Dorset Down x Coopworth lambs, ‘AC’ genotype was found to be associated with age corrected carcass weight (Palmer et al., 1999a). Further, Kocwin and Kuryl (2003) reported that the animals with CAST genotype (PCR-RFLP) ‘AA’ had significantly higher ham weight and weight of the loin muscle in Landrace pigs.

Table 4: Association between CAST genotypes and mean values of carcass primal cuts and meat and bone composition of cuts in Bandur ram lambs

NS: non significant

Association between CAST Genotypes and Meat Quality Traits

The association between the CAST genotypes and meat quality traits are presented in Table 5.

Table 5:  Association between CAST genotypes and mean values of meat quality traits in Bandur ram lambs

Means bearing same superscripts do not differ significantly; *** Significant (P<0.001), NS: non significant

The Warner-Bratzler shear force value of NN genotype was significantly (P<0.001) lower than MM and NN genotype indicated more tenderness of meat. There was no significant difference between meat quality traits such as pH, WHC, cooking loss, back fat thickness and Hunter color score, and CAST genotypes. Similar to the present study, ewes genotyped as ‘AC’ had significantly higher (P<0.05) shear force measurement than ‘AA’ or ‘AB’ (Palmer et al., 1999b) and No significant association between the CAST genotypes and meat quality traits viz., pH, tenderness, water holding capacity and cooking loss was observed in local thin tail sheep (Dagong et al., 2012).

Supporting to the present study, Schenkel et al. (2006) reported that the animals with ‘CC’ genotype yielded beef that was more tender and had greater fat yield (1.44 ± 0.56%)( P<0.05) than GG genotype.

The association of CAST genotypes with proximate principles and fatty acid profile are presented in Table 6.

Table 6:  Association between CAST genotypes and mean values of proximate principles and fatty acid profile in Bandur ram lambs

Means bearing same superscripts do not differ significantly; *Significant (P<0.05), NS: non significant

The ash content was significantly higher (P<0.05) in NN genotype. There was no significant difference between the other proximate principles analysis parameter or fatty acid profile and CAST genotypes. There are no earlier reports on association between CAST genotypes and proximate principles and fatty acid profile in Bandur and other sheep breeds for comparison.

In nutshell, this study is the first report on the association of CAST genotypes with carcass and meat quality traits in Bandur lams. The genetic variability in calpastatin loci was successfully determined by PCR-RFLP in Bandur sheep. High loin eye area recorded indicated higher muscular development in Bandur ram lambs. The lambs genotyped as NN had more tender meat than MM and NN genotyped lambs.

Conclusion

It may be concluded that CAST gene has potential effect on meat tenderness and may be considered as candidate gene to improve meat tenderness in sheep, especially in Bandur sheep. But, further confirmation is warranted involving larger population size.

Acknowledgement

The authors duly acknowledge the support rendered by Dr. Robinson J J Abraham, Professor and Head, Dr. Appa Rao, V., Professor and Mr. Surya Kumar, K.M., Senior Assistant, Dept. of Meat Science and Technology, Madras Veterinary College, TANUVAS, Chennai, in sparing their laboratory facilities, technical guidance and co-operation to carryout part of this study.

References

1. Ata N, Cemal I. 2013. Calpastatin gene polymorphism in Cine Capari and Karya Sheep. Scientific Papers Series D Animal Science. 55: 48-51.
2. Azari MA, Dehnavi E, Yousefi S and Shahmohamdi L. 2012. Polymorphism of Calpastatin, Calpain and Myostatin genes in native Dalagh sheep in Iran. Slovak Journal of Animal Science. 45(1): 1-6.
3. 2012. Polymorphism in the meat production and meat quality associated genes in sheep breeds. Research Contributions 1962-2012, Central Sheep and Wool Research Institute, Avikanagar, Rajasthan. pp.76.
4. Dagong MIA, Sumantri C, Noor RR, Herman R and Yamin M. 2012. Physical meat characteristics of local thin tail sheep based on Calpastatin (CAST) genotype variation. In: Proceeding of the 2^nd International Seminar on Animal Industry, Jakarta, 5-6^th July; 2012.
5. Dehnavi E, Azari MA, Hasani S, Nassiry MR, Mohajer M, Khan Ahmadi AR, Shahmohamadi L and Yousefi S. 2012. Association between yearling weight and calpastatin and calpain loci polymorphism in Iranian Zel sheep. Iranian Journal of Applied Animal Science. 2(2): 131-135.
6. Elyasi ZG, Shoja J, Nasiri MR, Pirahari OAB and Javanmard A. 2009. Allelic and Genotypic frequency of Calpastatin gene in Ghezel and Arkhamerino sheep and their crossbreds. Journal of New Agricultural Science (Modern Science of Sustainable Agriculture). 4(13): 1-6.
7. Gabor M, Trakovicka A and Miluchova M. 2009. Analysis of polymorphism of CAST Gene and CLPG Gene in Sheep by PCR – RFLP Method. Scientific Papers Animal Science and Biotechnologies. 42(2): 470-476.
8. Gerrard F. 1964. Meat Technology. 3^rd Edition, Leonard Hill Limited, London.
9. Gharahveysi S, Abbasi HA, Irani M, Abdullahpour R and Mirhabibi S. 2012. Polymorphism investigation of calpastatin gene in Zel sheep population of Iran by PCR-RFLP method. African Journal of Biotechnology. 11(13): 3211-3214.
10. Goll DE, Thompson VF, Li H, Wei W and Cong J. 2003. The Calpain System. Physiological Reviews. 83: 731-801.
11. Grau WR and Hamm R. 1953. Muscle as food. Food Science and Technology, a Series of Monographs. Academic Press, New York, NY, USA.
12. Grau WR and Hamm R. 1957. The water retention capacity of the mammalian muscle. Mag. Food Invest. Res. 105: 446.
13. 1995. Indian standard: Meat and Meat products – Mutton and Goat meat (chevon) – Fresh, chilled and frozen, technical requirements (first revision). Bureau of Indian Standard Institution Ed. 2.1 (2004-05), New Delhi, India.
14. Kocwin MP and Kuryl J. 2003. The effect of interaction between genotype at loci CAST, RYR1 and RN on pig carcass quality and pork traits. Animal Science Papers and Reports. 21: 61-65.
15. Miller SA, Dykes DD and Polesky HF. 1988. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Research. 16: 1215.
16. Nanekarani S, Asadi N and Khederzaheh S. 2011. Genotypic frequency of Calpastatin Gene in Lori Sheep by PCR-RFLP Method. In: Proceedings of 2^nd International Conference on Environment Science and Development. Singapore 4: 148 – 150.
17. Nassiry MR, Shahroudi FE, Tahmoorespour M and Javadmanesh A. 2007. Genetic variability and population structure in Beta-lactoglobulin, Calpastatin and Calpain Loci in Iranian Kurdi Sheep. Pakistan Journal of Biological Sciences. 10(7): 1062-1067.
18. Nassiry MR, Tahmoorespour M, Javadmanesh A, Soltani M and Far SF. 2006. Calpastatin Polymorphism and its Association with Daily Gain in Kurdi Sheep. Iran Journal of Biotechnology. 4(3): 188-192.
19. Nikmard M, Molace V, Eskandarinasab MP, Djadid ND and Vajhi AR. 2012. Calpastatin polymorphism in Afshari sheep and its possible correlation with growth and carcass traits. Journal of Applied Animal Research. 40(4): 346-350.
20. Palmer BR, Morton JD and Roberts N. 1999a. Marker–assisted selection for meat quality and the ovine calpastatin gene. Proceedings of the New Zealand Society of Animal Production. 59: 266-268.
21. Palmer BR, Roberts N and Kent MP. 1999b. A candidate gene approach to animal quality traits. Proceedings of the New Zealand Society of Animal Production. 57: 294-296.
22. Palmer BR, Roberts N, Hickford JG and Bickerstaffe R. 1998. Rapid communication: PCR-RFLP for MspI and NcoI in the ovine calpastatin gene. Journal of Animal Science. 76: 1499-1500.
23. Rosner B. 2005. Fundamentals of Biostatistics. Duxbury Press, USA.
24. SAS 9.3. 2011. SAS Institute Inc., Cary, NC, USA.
25. Schenkel FS, Miller SP, Jiang Z, Mandell IB, Ye X, Li H and Wilton JW. 2006. Association of a single nucleotide polymorphism in the calpastatin gene with carcass and meat quality of beef cattle. Journal of Animal Science. 84: 291-299.
26. Shahroudi FE, Nassiry MR, Valizadh R, Moussavi AH, Tahmoorespour M and Ghiasi, H. 2006. Genetic polymorphism at MTNR1A, CAST and CAPN loci in Iranian Karakul sheep. Iranian Journal of Biotechnology. 4(2): 117-122.
27. Snedecor CW and Cochran WG. 1989. Statistical Methods, 8^th Ames: Iowa State University Press, USA.
28. Suleman M, Khan SU, Riaz MN, Yousaf M, Abdullah, Shah, Ishaq R and Ghafoor A. 2012. Calpastatin (CAST) gene polymorphism in Kajli, Lohi and Thalli sheep breeds. African Journal of Biotechnology. 11(47): 10655-10660.
29. Sutikno, Yamin M and Sumantri C. 2011. Association of polymorphisms Calpastatin Gene with Body Weight of Local Sheep in Jonggol, Indonesia. Media Peternakan- Journal of Animal Science and Technology. 1-6.
30. Szkudlarek-Kowalczyk M, Wisniewska E and Mroczkowski S. 2011. Polymorphisms of calpastatin gene in sheep. Journal of Central European Agriculture. 12(3): 425-432.