Association of IGF1 Gene Polymorphism with Growth Rates in Madras Red Sheep

Authors

  • Chitra Ramasamy Veterinary College and Research Institute, Tamilnadu Veterinary and Animal Sciences University (TANUVAS), Namakkal – 637 002, Tamil Nadu, INDIA

Keywords:

Exon 1, Genetic Polymorphism, IGF1 gene, Madras Red Sheep, PCR-SSCP

Abstract

Insulin-like growth factors (IGFs), formerly called somatomedin, are members of a family of insulin related peptides. Insulin-like growth factors 1 (IGF-1) plays a key role in mammalian growth, lactation and metabolism, by stimulating anabolic processes such as cell proliferation, skeleton and hair growth and protein synthesis. The aim of this study was to investigate the association of IGF1 (exon1) gene polymorphism with growth rates in Madras Red sheep. Blood samples were collected from 66 animals maintained at Post Graduate Research Institute in Animal Sciences, Kattupakkam and 70 animals from farmers’ flock in the breeding tract of Madras Red sheep and DNA was isolated using high salt method. The animals were genotyped by Polymerase Chain Reaction – Single Strand Conformation Polymorphism (PCR-SSCP). In the PCR reaction the primers used were 5’ ATTACAGCTGCCTGCCCCTT 3’ and 5’ CACATCTGCTTACACCTTACCCG 3’. A 265 bp long IGF1 (exon1) gene PCR product was genotyped for polymorphic pattern using SSCP method. The PCR-SSCP analysis of exon1 IGF-I revealed three distinct patterns viz., AA, AG and GG and the genotype frequencies were in the order of 0.963, 0.022 and 0.015. In the present study, no significant effect (P>0.05) was observed between genotypes on all age groups in Madras Red sheep.

Downloads

Published

31-07-2018

How to Cite

Ramasamy, C. (2018). Association of IGF1 Gene Polymorphism with Growth Rates in Madras Red Sheep. International Journal of Livestock Research, 8(7), 131–137. Retrieved from https://ijlr.org/ojs_journal/index.php/ijlr/article/view/1701

Similar Articles

1 2 3 4 5 6 7 8 9 10 > >> 

You may also start an advanced similarity search for this article.